Incidental Mutation 'R5967:C8b'
ID470652
Institutional Source Beutler Lab
Gene Symbol C8b
Ensembl Gene ENSMUSG00000029656
Gene Namecomplement component 8, beta polypeptide
Synonyms4930439B20Rik
MMRRC Submission 043248-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5967 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location104766317-104804548 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104793333 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 446 (E446G)
Ref Sequence ENSEMBL: ENSMUSP00000031663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031663] [ENSMUST00000065072]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031663
AA Change: E446G

PolyPhen 2 Score 0.792 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031663
Gene: ENSMUSG00000029656
AA Change: E446G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSP1 66 116 3.17e-7 SMART
LDLa 120 156 1.78e-10 SMART
MACPF 290 497 3.6e-65 SMART
Blast:EGF 501 534 9e-12 BLAST
TSP1 547 584 1.17e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065072
AA Change: E380G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000066940
Gene: ENSMUSG00000029656
AA Change: E380G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
TSP1 66 116 3.17e-7 SMART
LDLa 120 156 1.78e-10 SMART
MACPF 224 431 3.6e-65 SMART
Blast:EGF 435 468 1e-11 BLAST
TSP1 481 518 1.17e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta subunit of complement component C8 that participates in the assembly of the complement membrane attack complex. The encoded preproprotein undergoes proteolytic processing to generate the beta subunit, which associates with the alpha and gamma subunits to form a trimeric complement component, C8. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. This gene is located adjacent to the gene encoding the alpha subunit. [provided by RefSeq, Oct 2015]
PHENOTYPE: In a controlled microbial environment ("clean") laboratory, mice homozygous for an inactivating mutation of this gene are viable and fertile and exhibit no apparent abonormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C A 17: 23,712,358 G192W probably damaging Het
Agl T A 3: 116,793,708 D66V probably benign Het
Agrn G A 4: 156,175,103 P792S probably damaging Het
AI464131 G A 4: 41,497,830 A600V probably benign Het
Angptl2 A G 2: 33,228,706 N164S probably damaging Het
Birc6 T C 17: 74,660,439 F4112L probably damaging Het
Ceacam1 C T 7: 25,474,742 V163I probably damaging Het
Cngb1 T C 8: 95,251,906 K1068R probably damaging Het
Gna11 A G 10: 81,530,809 Y356H probably benign Het
Gnl2 A G 4: 125,041,030 M160V probably benign Het
Gpsm1 A G 2: 26,340,534 probably null Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Kif20a G T 18: 34,630,527 R609L probably benign Het
Meis2 G A 2: 115,864,309 T444I probably benign Het
Muc3 T A 5: 137,146,637 I62L probably benign Het
Ncor2 C T 5: 125,068,984 D526N unknown Het
Nodal G T 10: 61,423,667 E294D probably damaging Het
Nup214 T C 2: 31,979,778 V161A possibly damaging Het
Olfr1029 G A 2: 85,976,191 R316H probably benign Het
Olfr172 G T 16: 58,760,362 D271E probably damaging Het
Olfr514 C T 7: 108,825,714 G95D probably benign Het
Pclo A T 5: 14,540,655 T990S unknown Het
Piwil2 A T 14: 70,390,564 M752K probably benign Het
Ppargc1b A G 18: 61,298,766 S1004P probably damaging Het
Prkd1 A T 12: 50,364,550 M805K probably damaging Het
Rad23a T C 8: 84,838,939 E30G probably damaging Het
Ralbp1 A G 17: 65,864,279 V233A probably benign Het
Scin C T 12: 40,077,538 E418K probably benign Het
Scn7a T A 2: 66,675,713 I1611F probably damaging Het
Slit2 A T 5: 47,985,164 H42L probably damaging Het
Stard9 T A 2: 120,706,894 V4259D probably damaging Het
Trhde T A 10: 114,567,134 Y528F probably damaging Het
Txlnb A G 10: 17,799,420 E107G probably damaging Het
Zfp715 T C 7: 43,299,148 T463A probably benign Het
Other mutations in C8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:C8b APN 4 104801334 splice site probably benign
IGL01145:C8b APN 4 104780580 missense probably benign 0.25
IGL01768:C8b APN 4 104786954 missense probably benign 0.00
IGL02347:C8b APN 4 104786954 missense probably benign 0.00
IGL02488:C8b APN 4 104804081 missense probably benign
IGL02957:C8b APN 4 104766455 missense probably benign
IGL02979:C8b APN 4 104774388 missense probably damaging 0.99
IGL02995:C8b APN 4 104801328 splice site probably benign
IGL03294:C8b APN 4 104780691 missense probably benign 0.06
R0568:C8b UTSW 4 104793380 missense probably benign 0.39
R1015:C8b UTSW 4 104786960 missense probably benign 0.19
R1191:C8b UTSW 4 104793323 missense probably damaging 1.00
R1401:C8b UTSW 4 104784482 missense possibly damaging 0.72
R3824:C8b UTSW 4 104783009 missense probably benign 0.42
R4611:C8b UTSW 4 104790644 missense probably damaging 0.98
R4756:C8b UTSW 4 104786886 missense probably benign
R4845:C8b UTSW 4 104791812 missense possibly damaging 0.87
R5355:C8b UTSW 4 104780663 missense probably benign 0.01
R5436:C8b UTSW 4 104800349 nonsense probably null
R5561:C8b UTSW 4 104784448 missense possibly damaging 0.89
R6744:C8b UTSW 4 104774346 missense probably damaging 1.00
R6899:C8b UTSW 4 104786874 missense probably benign 0.02
R6977:C8b UTSW 4 104786996 missense possibly damaging 0.82
R7088:C8b UTSW 4 104793343 missense probably benign 0.12
R7224:C8b UTSW 4 104780598 missense probably damaging 1.00
R7278:C8b UTSW 4 104780627 missense probably damaging 1.00
R8058:C8b UTSW 4 104790614 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGTCTCCCAGAAAGGTTCACTAC -3'
(R):5'- GCCTGTGCTTTGATGAGCTC -3'

Sequencing Primer
(F):5'- CGAAGTATCTCAATGGTTTGTTTAGC -3'
(R):5'- GCTTTGATGAGCTCCATGC -3'
Posted On2017-03-31