Incidental Mutation 'R5967:Ncor2'
ID470659
Institutional Source Beutler Lab
Gene Symbol Ncor2
Ensembl Gene ENSMUSG00000029478
Gene Namenuclear receptor co-repressor 2
SynonymsSMRT, SMRTe
MMRRC Submission 043248-MU
Accession Numbers

Ncbi RefSeq: NM_011424.3, NM_001253904.1, NM_001253905.1; MGI:1337080

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5967 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location125017153-125179219 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 125068984 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 526 (D526N)
Ref Sequence ENSEMBL: ENSMUSP00000107033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055256] [ENSMUST00000086083] [ENSMUST00000111393] [ENSMUST00000111394] [ENSMUST00000111398] [ENSMUST00000111402]
Predicted Effect unknown
Transcript: ENSMUST00000055256
AA Change: D526N
SMART Domains Protein: ENSMUSP00000055954
Gene: ENSMUSG00000029478
AA Change: D526N

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 989 1000 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1027 1043 N/A INTRINSIC
low complexity region 1086 1096 N/A INTRINSIC
low complexity region 1100 1116 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1481 1497 N/A INTRINSIC
low complexity region 1616 1622 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1737 1754 N/A INTRINSIC
low complexity region 1764 1776 N/A INTRINSIC
low complexity region 1800 1807 N/A INTRINSIC
low complexity region 1921 1939 N/A INTRINSIC
low complexity region 1959 1975 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
PDB:2GPV|I 2293 2314 8e-8 PDB
low complexity region 2324 2336 N/A INTRINSIC
low complexity region 2433 2453 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000086083
AA Change: D526N
SMART Domains Protein: ENSMUSP00000083250
Gene: ENSMUSG00000029478
AA Change: D526N

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1364 1378 N/A INTRINSIC
low complexity region 1479 1495 N/A INTRINSIC
low complexity region 1614 1620 N/A INTRINSIC
low complexity region 1707 1724 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
low complexity region 1762 1774 N/A INTRINSIC
low complexity region 1798 1805 N/A INTRINSIC
low complexity region 1916 1934 N/A INTRINSIC
low complexity region 1954 1970 N/A INTRINSIC
low complexity region 2057 2071 N/A INTRINSIC
PDB:2GPV|I 2288 2309 8e-8 PDB
low complexity region 2319 2331 N/A INTRINSIC
low complexity region 2428 2448 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111393
AA Change: D351N
SMART Domains Protein: ENSMUSP00000107024
Gene: ENSMUSG00000029478
AA Change: D351N

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
SANT 253 301 4.42e-6 SMART
coiled coil region 319 375 N/A INTRINSIC
SANT 432 480 1.43e-14 SMART
low complexity region 493 511 N/A INTRINSIC
low complexity region 524 551 N/A INTRINSIC
low complexity region 593 638 N/A INTRINSIC
low complexity region 647 653 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 692 699 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
low complexity region 760 769 N/A INTRINSIC
low complexity region 813 824 N/A INTRINSIC
low complexity region 835 849 N/A INTRINSIC
low complexity region 851 867 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
low complexity region 1225 1239 N/A INTRINSIC
low complexity region 1340 1356 N/A INTRINSIC
low complexity region 1475 1481 N/A INTRINSIC
low complexity region 1568 1585 N/A INTRINSIC
low complexity region 1596 1613 N/A INTRINSIC
low complexity region 1623 1635 N/A INTRINSIC
low complexity region 1659 1666 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
low complexity region 1921 1935 N/A INTRINSIC
PDB:2GPV|I 2152 2173 7e-8 PDB
low complexity region 2183 2195 N/A INTRINSIC
low complexity region 2292 2312 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111394
AA Change: D307N
SMART Domains Protein: ENSMUSP00000107025
Gene: ENSMUSG00000029478
AA Change: D307N

DomainStartEndE-ValueType
SANT 209 257 4.42e-6 SMART
coiled coil region 275 331 N/A INTRINSIC
SANT 388 436 1.43e-14 SMART
low complexity region 449 467 N/A INTRINSIC
low complexity region 480 507 N/A INTRINSIC
low complexity region 549 594 N/A INTRINSIC
low complexity region 603 609 N/A INTRINSIC
low complexity region 629 641 N/A INTRINSIC
low complexity region 648 655 N/A INTRINSIC
low complexity region 686 700 N/A INTRINSIC
low complexity region 716 725 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 791 805 N/A INTRINSIC
low complexity region 807 823 N/A INTRINSIC
low complexity region 866 876 N/A INTRINSIC
low complexity region 880 896 N/A INTRINSIC
low complexity region 1146 1160 N/A INTRINSIC
low complexity region 1261 1277 N/A INTRINSIC
low complexity region 1396 1402 N/A INTRINSIC
low complexity region 1489 1506 N/A INTRINSIC
low complexity region 1517 1534 N/A INTRINSIC
low complexity region 1544 1556 N/A INTRINSIC
low complexity region 1580 1587 N/A INTRINSIC
low complexity region 1701 1719 N/A INTRINSIC
low complexity region 1739 1755 N/A INTRINSIC
low complexity region 1842 1856 N/A INTRINSIC
PDB:2GPV|I 2073 2094 7e-8 PDB
low complexity region 2104 2116 N/A INTRINSIC
low complexity region 2213 2233 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111398
AA Change: D526N
SMART Domains Protein: ENSMUSP00000107029
Gene: ENSMUSG00000029478
AA Change: D526N

DomainStartEndE-ValueType
low complexity region 147 154 N/A INTRINSIC
coiled coil region 167 207 N/A INTRINSIC
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1365 1379 N/A INTRINSIC
low complexity region 1480 1496 N/A INTRINSIC
low complexity region 1615 1621 N/A INTRINSIC
low complexity region 1708 1725 N/A INTRINSIC
low complexity region 1736 1753 N/A INTRINSIC
low complexity region 1763 1775 N/A INTRINSIC
low complexity region 1799 1806 N/A INTRINSIC
low complexity region 1920 1938 N/A INTRINSIC
low complexity region 1958 1974 N/A INTRINSIC
low complexity region 2061 2075 N/A INTRINSIC
PDB:2GPV|I 2292 2313 8e-8 PDB
low complexity region 2323 2335 N/A INTRINSIC
low complexity region 2432 2452 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111402
AA Change: D526N
SMART Domains Protein: ENSMUSP00000107033
Gene: ENSMUSG00000029478
AA Change: D526N

DomainStartEndE-ValueType
Pfam:GPS2_interact 141 229 4.9e-41 PFAM
SANT 428 476 4.42e-6 SMART
coiled coil region 494 550 N/A INTRINSIC
SANT 607 655 1.43e-14 SMART
low complexity region 668 686 N/A INTRINSIC
low complexity region 699 726 N/A INTRINSIC
low complexity region 768 813 N/A INTRINSIC
low complexity region 822 828 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 867 874 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 935 944 N/A INTRINSIC
low complexity region 988 999 N/A INTRINSIC
low complexity region 1010 1024 N/A INTRINSIC
low complexity region 1026 1042 N/A INTRINSIC
low complexity region 1085 1095 N/A INTRINSIC
low complexity region 1099 1115 N/A INTRINSIC
low complexity region 1400 1414 N/A INTRINSIC
low complexity region 1515 1531 N/A INTRINSIC
low complexity region 1650 1656 N/A INTRINSIC
low complexity region 1743 1760 N/A INTRINSIC
low complexity region 1771 1788 N/A INTRINSIC
low complexity region 1798 1810 N/A INTRINSIC
low complexity region 1834 1841 N/A INTRINSIC
low complexity region 1955 1973 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2096 2110 N/A INTRINSIC
PDB:2GPV|I 2327 2348 8e-8 PDB
low complexity region 2358 2370 N/A INTRINSIC
low complexity region 2467 2487 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype Strain: 3765904; 4329504
Lethality: E1-E16
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear receptor co-repressor that mediates transcriptional silencing of certain target genes. The encoded protein is a member of a family of thyroid hormone- and retinoic acid receptor-associated co-repressors. This protein acts as part of a multisubunit complex which includes histone deacetylases to modify chromatin structure that prevents basal transcriptional activity of target genes. Aberrant expression of this gene is associated with certain cancers. Alternate splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a null allele die before E16.5 of heart defects and exhibit neural defects. [provided by MGI curators]
Allele List at MGI

All alleles(145) : Targeted(2) Gene trapped(143)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C A 17: 23,712,358 G192W probably damaging Het
Agl T A 3: 116,793,708 D66V probably benign Het
Agrn G A 4: 156,175,103 P792S probably damaging Het
AI464131 G A 4: 41,497,830 A600V probably benign Het
Angptl2 A G 2: 33,228,706 N164S probably damaging Het
Birc6 T C 17: 74,660,439 F4112L probably damaging Het
C8b A G 4: 104,793,333 E446G possibly damaging Het
Ceacam1 C T 7: 25,474,742 V163I probably damaging Het
Cngb1 T C 8: 95,251,906 K1068R probably damaging Het
Gna11 A G 10: 81,530,809 Y356H probably benign Het
Gnl2 A G 4: 125,041,030 M160V probably benign Het
Gpsm1 A G 2: 26,340,534 probably null Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Kif20a G T 18: 34,630,527 R609L probably benign Het
Meis2 G A 2: 115,864,309 T444I probably benign Het
Muc3 T A 5: 137,146,637 I62L probably benign Het
Nodal G T 10: 61,423,667 E294D probably damaging Het
Nup214 T C 2: 31,979,778 V161A possibly damaging Het
Olfr1029 G A 2: 85,976,191 R316H probably benign Het
Olfr172 G T 16: 58,760,362 D271E probably damaging Het
Olfr514 C T 7: 108,825,714 G95D probably benign Het
Pclo A T 5: 14,540,655 T990S unknown Het
Piwil2 A T 14: 70,390,564 M752K probably benign Het
Ppargc1b A G 18: 61,298,766 S1004P probably damaging Het
Prkd1 A T 12: 50,364,550 M805K probably damaging Het
Rad23a T C 8: 84,838,939 E30G probably damaging Het
Ralbp1 A G 17: 65,864,279 V233A probably benign Het
Scin C T 12: 40,077,538 E418K probably benign Het
Scn7a T A 2: 66,675,713 I1611F probably damaging Het
Slit2 A T 5: 47,985,164 H42L probably damaging Het
Stard9 T A 2: 120,706,894 V4259D probably damaging Het
Trhde T A 10: 114,567,134 Y528F probably damaging Het
Txlnb A G 10: 17,799,420 E107G probably damaging Het
Zfp715 T C 7: 43,299,148 T463A probably benign Het
Other mutations in Ncor2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Ncor2 APN 5 125042743 critical splice donor site probably null
IGL00519:Ncor2 APN 5 125084924 missense unknown
IGL00900:Ncor2 APN 5 125025784 missense probably damaging 1.00
IGL00950:Ncor2 APN 5 125086890 missense unknown
IGL01320:Ncor2 APN 5 125109927 missense probably benign 0.00
IGL01382:Ncor2 APN 5 125055773 missense probably damaging 0.96
IGL01573:Ncor2 APN 5 125085026 missense unknown
IGL01721:Ncor2 APN 5 125050937 missense probably damaging 1.00
IGL01875:Ncor2 APN 5 125065870 missense unknown
IGL02090:Ncor2 APN 5 125034403 missense probably damaging 0.99
IGL02192:Ncor2 APN 5 125024237 missense probably damaging 1.00
IGL02396:Ncor2 APN 5 125037914 missense probably damaging 1.00
IGL02934:Ncor2 APN 5 125025557 missense probably benign 0.33
IGL02997:Ncor2 APN 5 125119570 intron probably benign
R0019:Ncor2 UTSW 5 125119481 critical splice donor site probably null
R0331:Ncor2 UTSW 5 125084917 missense unknown
R0333:Ncor2 UTSW 5 125034344 splice site probably benign
R0403:Ncor2 UTSW 5 125033337 missense possibly damaging 0.73
R0557:Ncor2 UTSW 5 125106305 nonsense probably null
R0562:Ncor2 UTSW 5 125085029 missense unknown
R0671:Ncor2 UTSW 5 125049387 missense probably benign 0.13
R0699:Ncor2 UTSW 5 125029112 unclassified probably benign
R0865:Ncor2 UTSW 5 125038982 missense probably benign 0.17
R1183:Ncor2 UTSW 5 125023521 missense possibly damaging 0.65
R1325:Ncor2 UTSW 5 125118780 intron probably benign
R1344:Ncor2 UTSW 5 125025446 missense probably damaging 1.00
R1433:Ncor2 UTSW 5 125109975 intron probably benign
R1481:Ncor2 UTSW 5 125027138 nonsense probably null
R1539:Ncor2 UTSW 5 125109939 missense probably benign 0.07
R1558:Ncor2 UTSW 5 125033546 missense probably damaging 1.00
R1585:Ncor2 UTSW 5 125084998 missense unknown
R1611:Ncor2 UTSW 5 125110020 intron probably benign
R1764:Ncor2 UTSW 5 125028615 missense possibly damaging 0.91
R1789:Ncor2 UTSW 5 125019890 missense probably damaging 1.00
R1809:Ncor2 UTSW 5 125118793 intron probably benign
R1901:Ncor2 UTSW 5 125025425 missense probably benign 0.39
R1946:Ncor2 UTSW 5 125034412 missense probably damaging 1.00
R1970:Ncor2 UTSW 5 125038918 missense probably damaging 0.99
R2048:Ncor2 UTSW 5 125084932 missense unknown
R2137:Ncor2 UTSW 5 125030712 missense probably damaging 1.00
R2270:Ncor2 UTSW 5 125037955 missense probably benign 0.33
R2380:Ncor2 UTSW 5 125036080 missense possibly damaging 0.89
R2570:Ncor2 UTSW 5 125028800 critical splice acceptor site probably null
R2918:Ncor2 UTSW 5 125025760 missense probably damaging 0.99
R2921:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R2922:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R2923:Ncor2 UTSW 5 125055791 missense probably damaging 1.00
R3116:Ncor2 UTSW 5 125024166 missense probably damaging 1.00
R3768:Ncor2 UTSW 5 125028687 missense probably damaging 1.00
R3826:Ncor2 UTSW 5 125118692 intron probably benign
R3829:Ncor2 UTSW 5 125118692 intron probably benign
R3830:Ncor2 UTSW 5 125118692 intron probably benign
R3951:Ncor2 UTSW 5 125032256 missense possibly damaging 0.94
R4175:Ncor2 UTSW 5 125050956 missense probably damaging 0.99
R4360:Ncor2 UTSW 5 125028972 missense probably damaging 1.00
R4470:Ncor2 UTSW 5 125102641 critical splice donor site probably null
R4490:Ncor2 UTSW 5 125036815 splice site probably null
R4573:Ncor2 UTSW 5 125055825 missense probably damaging 0.99
R4611:Ncor2 UTSW 5 125030859 missense probably damaging 1.00
R4799:Ncor2 UTSW 5 125037060 critical splice donor site probably null
R4851:Ncor2 UTSW 5 125033367 missense possibly damaging 0.93
R4853:Ncor2 UTSW 5 125025105 missense probably damaging 0.99
R4853:Ncor2 UTSW 5 125081183 missense unknown
R4896:Ncor2 UTSW 5 125049340 critical splice donor site probably null
R4997:Ncor2 UTSW 5 125034010 missense probably damaging 0.99
R5057:Ncor2 UTSW 5 125048066 missense possibly damaging 0.86
R5253:Ncor2 UTSW 5 125026930 missense probably benign 0.44
R5461:Ncor2 UTSW 5 125027113 missense probably damaging 1.00
R5585:Ncor2 UTSW 5 125067911 nonsense probably null
R5638:Ncor2 UTSW 5 125048300 missense probably benign 0.33
R5879:Ncor2 UTSW 5 125026775 unclassified probably benign
R5999:Ncor2 UTSW 5 125033441 missense probably damaging 1.00
R6020:Ncor2 UTSW 5 125020011 missense probably benign 0.14
R6109:Ncor2 UTSW 5 125055846 missense probably damaging 1.00
R6423:Ncor2 UTSW 5 125087902 missense unknown
R6462:Ncor2 UTSW 5 125024172 missense probably damaging 1.00
R6478:Ncor2 UTSW 5 125110005 intron probably benign
R7074:Ncor2 UTSW 5 125049366 nonsense probably null
R7179:Ncor2 UTSW 5 125055783 missense unknown
R7261:Ncor2 UTSW 5 125110079 splice site probably null
R7263:Ncor2 UTSW 5 125032132 missense
R7273:Ncor2 UTSW 5 125023623 missense
R7282:Ncor2 UTSW 5 125020040 missense
R7570:Ncor2 UTSW 5 125030089 missense
R7725:Ncor2 UTSW 5 125023566 missense
R7747:Ncor2 UTSW 5 125027038 missense
R7748:Ncor2 UTSW 5 125109967 missense unknown
R7825:Ncor2 UTSW 5 125037077 missense possibly damaging 0.53
R8008:Ncor2 UTSW 5 125067919 missense unknown
R8126:Ncor2 UTSW 5 125106204 missense unknown
R8137:Ncor2 UTSW 5 125037893 missense
Z1088:Ncor2 UTSW 5 125067788 missense unknown
Z1088:Ncor2 UTSW 5 125086840 critical splice donor site probably null
Z1177:Ncor2 UTSW 5 125036849 missense
Z1177:Ncor2 UTSW 5 125047994 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCAGTCTCCTAGGTCTCTTGG -3'
(R):5'- ACCCGAGTGTGGTGCTTTTC -3'

Sequencing Primer
(F):5'- GAGAAGCGGGGGTGTGC -3'
(R):5'- AGTTGCCCTGGCCTCTG -3'
Posted On2017-03-31