Incidental Mutation 'R5967:Olfr514'
ID470665
Institutional Source Beutler Lab
Gene Symbol Olfr514
Ensembl Gene ENSMUSG00000066241
Gene Nameolfactory receptor 514
SynonymsMOR268-1, GA_x6K02T2PBJ9-11156311-11155379
MMRRC Submission 043248-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R5967 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108825065-108825997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108825714 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 95 (G95D)
Ref Sequence ENSEMBL: ENSMUSP00000081807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084754]
Predicted Effect probably benign
Transcript: ENSMUST00000084754
AA Change: G95D

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081807
Gene: ENSMUSG00000066241
AA Change: G95D

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 3.9e-57 PFAM
Pfam:7tm_1 40 289 5e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C A 17: 23,712,358 G192W probably damaging Het
Agl T A 3: 116,793,708 D66V probably benign Het
Agrn G A 4: 156,175,103 P792S probably damaging Het
AI464131 G A 4: 41,497,830 A600V probably benign Het
Angptl2 A G 2: 33,228,706 N164S probably damaging Het
Birc6 T C 17: 74,660,439 F4112L probably damaging Het
C8b A G 4: 104,793,333 E446G possibly damaging Het
Ceacam1 C T 7: 25,474,742 V163I probably damaging Het
Cngb1 T C 8: 95,251,906 K1068R probably damaging Het
Gna11 A G 10: 81,530,809 Y356H probably benign Het
Gnl2 A G 4: 125,041,030 M160V probably benign Het
Gpsm1 A G 2: 26,340,534 probably null Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Kif20a G T 18: 34,630,527 R609L probably benign Het
Meis2 G A 2: 115,864,309 T444I probably benign Het
Muc3 T A 5: 137,146,637 I62L probably benign Het
Ncor2 C T 5: 125,068,984 D526N unknown Het
Nodal G T 10: 61,423,667 E294D probably damaging Het
Nup214 T C 2: 31,979,778 V161A possibly damaging Het
Olfr1029 G A 2: 85,976,191 R316H probably benign Het
Olfr172 G T 16: 58,760,362 D271E probably damaging Het
Pclo A T 5: 14,540,655 T990S unknown Het
Piwil2 A T 14: 70,390,564 M752K probably benign Het
Ppargc1b A G 18: 61,298,766 S1004P probably damaging Het
Prkd1 A T 12: 50,364,550 M805K probably damaging Het
Rad23a T C 8: 84,838,939 E30G probably damaging Het
Ralbp1 A G 17: 65,864,279 V233A probably benign Het
Scin C T 12: 40,077,538 E418K probably benign Het
Scn7a T A 2: 66,675,713 I1611F probably damaging Het
Slit2 A T 5: 47,985,164 H42L probably damaging Het
Stard9 T A 2: 120,706,894 V4259D probably damaging Het
Trhde T A 10: 114,567,134 Y528F probably damaging Het
Txlnb A G 10: 17,799,420 E107G probably damaging Het
Zfp715 T C 7: 43,299,148 T463A probably benign Het
Other mutations in Olfr514
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Olfr514 APN 7 108825073 missense probably benign 0.00
IGL01469:Olfr514 APN 7 108825327 missense probably benign 0.29
IGL02079:Olfr514 APN 7 108825936 missense probably damaging 0.99
IGL02330:Olfr514 APN 7 108825999 unclassified probably benign
IGL02662:Olfr514 APN 7 108825745 missense probably benign 0.16
IGL02713:Olfr514 APN 7 108825594 missense probably damaging 1.00
R1158:Olfr514 UTSW 7 108825178 missense probably damaging 1.00
R1610:Olfr514 UTSW 7 108825924 missense probably benign
R1638:Olfr514 UTSW 7 108825235 missense probably benign 0.03
R4242:Olfr514 UTSW 7 108825459 missense probably benign
R4630:Olfr514 UTSW 7 108825595 missense probably damaging 1.00
R5042:Olfr514 UTSW 7 108825471 missense possibly damaging 0.72
R7180:Olfr514 UTSW 7 108825979 missense probably damaging 0.98
Z1088:Olfr514 UTSW 7 108825896 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGTCATGATACCCAAGACCC -3'
(R):5'- TCCAAGTACACATGTTTGGAGC -3'

Sequencing Primer
(F):5'- TGTCATGATACCCAAGACCCATGAG -3'
(R):5'- TATCTGGTGACTCTGACAGGAAATGC -3'
Posted On2017-03-31