Incidental Mutation 'R5967:Txlnb'
ID470670
Institutional Source Beutler Lab
Gene Symbol Txlnb
Ensembl Gene ENSMUSG00000039891
Gene Nametaxilin beta
Synonyms2310001N14Rik, Mdp77
MMRRC Submission 043248-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5967 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location17796226-17845665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17799420 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 107 (E107G)
Ref Sequence ENSEMBL: ENSMUSP00000044936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037964]
Predicted Effect probably damaging
Transcript: ENSMUST00000037964
AA Change: E107G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044936
Gene: ENSMUSG00000039891
AA Change: E107G

DomainStartEndE-ValueType
internal_repeat_2 5 22 2.13e-6 PROSPERO
internal_repeat_1 25 93 4.27e-8 PROSPERO
low complexity region 115 128 N/A INTRINSIC
Pfam:Taxilin 145 454 3.1e-122 PFAM
low complexity region 477 491 N/A INTRINSIC
internal_repeat_2 543 560 2.13e-6 PROSPERO
low complexity region 575 591 N/A INTRINSIC
internal_repeat_1 600 659 4.27e-8 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181428
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik C A 17: 23,712,358 G192W probably damaging Het
Agl T A 3: 116,793,708 D66V probably benign Het
Agrn G A 4: 156,175,103 P792S probably damaging Het
AI464131 G A 4: 41,497,830 A600V probably benign Het
Angptl2 A G 2: 33,228,706 N164S probably damaging Het
Birc6 T C 17: 74,660,439 F4112L probably damaging Het
C8b A G 4: 104,793,333 E446G possibly damaging Het
Ceacam1 C T 7: 25,474,742 V163I probably damaging Het
Cngb1 T C 8: 95,251,906 K1068R probably damaging Het
Gna11 A G 10: 81,530,809 Y356H probably benign Het
Gnl2 A G 4: 125,041,030 M160V probably benign Het
Gpsm1 A G 2: 26,340,534 probably null Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Kif20a G T 18: 34,630,527 R609L probably benign Het
Meis2 G A 2: 115,864,309 T444I probably benign Het
Muc3 T A 5: 137,146,637 I62L probably benign Het
Ncor2 C T 5: 125,068,984 D526N unknown Het
Nodal G T 10: 61,423,667 E294D probably damaging Het
Nup214 T C 2: 31,979,778 V161A possibly damaging Het
Olfr1029 G A 2: 85,976,191 R316H probably benign Het
Olfr172 G T 16: 58,760,362 D271E probably damaging Het
Olfr514 C T 7: 108,825,714 G95D probably benign Het
Pclo A T 5: 14,540,655 T990S unknown Het
Piwil2 A T 14: 70,390,564 M752K probably benign Het
Ppargc1b A G 18: 61,298,766 S1004P probably damaging Het
Prkd1 A T 12: 50,364,550 M805K probably damaging Het
Rad23a T C 8: 84,838,939 E30G probably damaging Het
Ralbp1 A G 17: 65,864,279 V233A probably benign Het
Scin C T 12: 40,077,538 E418K probably benign Het
Scn7a T A 2: 66,675,713 I1611F probably damaging Het
Slit2 A T 5: 47,985,164 H42L probably damaging Het
Stard9 T A 2: 120,706,894 V4259D probably damaging Het
Trhde T A 10: 114,567,134 Y528F probably damaging Het
Zfp715 T C 7: 43,299,148 T463A probably benign Het
Other mutations in Txlnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Txlnb APN 10 17842963 missense probably damaging 0.98
IGL01820:Txlnb APN 10 17806858 critical splice donor site probably null
IGL02244:Txlnb APN 10 17843368 missense probably benign 0.00
IGL02247:Txlnb APN 10 17830342 missense possibly damaging 0.55
IGL02247:Txlnb APN 10 17841528 splice site probably benign
IGL02931:Txlnb APN 10 17827982 missense probably damaging 1.00
IGL03006:Txlnb APN 10 17838975 missense probably damaging 0.96
IGL02991:Txlnb UTSW 10 17841453 missense probably damaging 1.00
R0092:Txlnb UTSW 10 17842755 missense possibly damaging 0.91
R0800:Txlnb UTSW 10 17799492 missense possibly damaging 0.50
R0908:Txlnb UTSW 10 17799177 missense probably damaging 1.00
R1172:Txlnb UTSW 10 17842756 missense probably benign 0.23
R1174:Txlnb UTSW 10 17842756 missense probably benign 0.23
R1340:Txlnb UTSW 10 17842740 missense probably damaging 1.00
R1373:Txlnb UTSW 10 17838947 missense probably damaging 1.00
R1641:Txlnb UTSW 10 17806773 missense possibly damaging 0.55
R1680:Txlnb UTSW 10 17843233 missense probably benign 0.01
R1710:Txlnb UTSW 10 17843455 missense possibly damaging 0.90
R1741:Txlnb UTSW 10 17838947 missense probably damaging 1.00
R1955:Txlnb UTSW 10 17799420 missense probably damaging 0.98
R2031:Txlnb UTSW 10 17830314 missense possibly damaging 0.85
R4300:Txlnb UTSW 10 17827925 missense probably damaging 1.00
R4483:Txlnb UTSW 10 17838997 nonsense probably null
R4484:Txlnb UTSW 10 17838997 nonsense probably null
R4656:Txlnb UTSW 10 17815276 missense probably damaging 1.00
R4664:Txlnb UTSW 10 17843194 missense probably damaging 0.99
R4723:Txlnb UTSW 10 17799267 missense probably benign 0.02
R4974:Txlnb UTSW 10 17838969 missense probably damaging 1.00
R5291:Txlnb UTSW 10 17799396 missense possibly damaging 0.92
R5538:Txlnb UTSW 10 17838909 missense probably damaging 1.00
R5791:Txlnb UTSW 10 17799128 missense probably benign 0.01
R6144:Txlnb UTSW 10 17843166 missense probably benign 0.17
R6212:Txlnb UTSW 10 17799309 missense probably damaging 1.00
R7146:Txlnb UTSW 10 17827798 missense possibly damaging 0.81
R7171:Txlnb UTSW 10 17842984 missense probably benign 0.22
R7253:Txlnb UTSW 10 17827885 missense probably damaging 1.00
R7468:Txlnb UTSW 10 17799334 missense probably damaging 0.96
R7608:Txlnb UTSW 10 17815398 missense probably damaging 0.98
R7936:Txlnb UTSW 10 17827964 missense probably benign 0.26
R8245:Txlnb UTSW 10 17841457 missense probably damaging 1.00
R8262:Txlnb UTSW 10 17843004 missense possibly damaging 0.90
R8435:Txlnb UTSW 10 17827796 missense probably damaging 1.00
X0025:Txlnb UTSW 10 17799422 missense probably benign 0.39
Z1177:Txlnb UTSW 10 17806806 missense probably benign 0.33
Z1177:Txlnb UTSW 10 17827804 missense probably damaging 1.00
Z1177:Txlnb UTSW 10 17833308 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGGGACAGCTCATCACTCAATC -3'
(R):5'- TGCATTGTATAAGGAAATGCCGG -3'

Sequencing Primer
(F):5'- CAAGAGGGAAGCCTGCATCC -3'
(R):5'- CATCCCAGCCCTTGAACAGG -3'
Posted On2017-03-31