Incidental Mutation 'R0499:Fshr'
ID47068
Institutional Source Beutler Lab
Gene Symbol Fshr
Ensembl Gene ENSMUSG00000032937
Gene Namefollicle stimulating hormone receptor
SynonymsFSH-R, Follitropin receptor, follicle-stimulating hormone receptor
MMRRC Submission 038695-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0499 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location88985170-89200612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 89009285 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 169 (S169T)
Ref Sequence ENSEMBL: ENSMUSP00000040477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035701]
Predicted Effect probably benign
Transcript: ENSMUST00000035701
AA Change: S169T

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000040477
Gene: ENSMUSG00000032937
AA Change: S169T

DomainStartEndE-ValueType
LRRNT 17 50 3.93e-3 SMART
Pfam:LRR_5 134 249 9e-7 PFAM
Pfam:GnHR_trans 282 348 4.6e-27 PFAM
Pfam:7tm_1 378 625 1.9e-30 PFAM
Meta Mutation Damage Score 0.2490 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to family 1 of G-protein coupled receptors. It is the receptor for follicle stimulating hormone and functions in gonad development. Mutations in this gene cause ovarian dysgenesis type 1, and also ovarian hyperstimulation syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mutant females are sterile with small ovaries, blocked follicular development, atrophic uterus and imperforate vagina. Mutant males are fertile despite reduction in testis weight, oligozoospermia and reduced testosterone levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad9 T C 3: 36,085,415 V388A probably damaging Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adap2 A T 11: 80,176,079 R276S probably damaging Het
Agbl3 A T 6: 34,839,335 M727L probably benign Het
Ahnak T A 19: 9,000,264 probably benign Het
Ankmy1 G T 1: 92,886,226 D410E probably damaging Het
Ankra2 T C 13: 98,266,454 S70P probably damaging Het
Aox4 T C 1: 58,263,397 probably null Het
Arl13b G A 16: 62,801,733 T399I probably benign Het
Atad2 A T 15: 58,103,240 D652E possibly damaging Het
Atad2 T G 15: 58,120,949 M328L probably benign Het
BC052040 C T 2: 115,642,691 R101W probably damaging Het
Ccnb1 T C 13: 100,780,134 probably null Het
Ccr2 G C 9: 124,105,939 K85N possibly damaging Het
Ccr2 A T 9: 124,106,126 T148S possibly damaging Het
Cdc20b T C 13: 113,055,950 V59A probably benign Het
Cdkl3 T C 11: 52,032,416 S507P possibly damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Ces1g A G 8: 93,333,689 F101L probably benign Het
Cntnap3 C T 13: 64,858,678 D107N probably benign Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col27a1 A G 4: 63,300,741 probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Cstf3 A G 2: 104,649,605 I272M possibly damaging Het
Cyp2d40 T C 15: 82,761,217 T150A probably benign Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dopey2 A T 16: 93,770,437 T1251S probably benign Het
Dtx2 G A 5: 136,029,103 G421R probably damaging Het
Dusp27 C A 1: 166,099,101 V981L probably benign Het
Epb41l3 T A 17: 69,247,659 D251E probably benign Het
Erg A C 16: 95,360,983 Y305* probably null Het
Exosc4 G A 15: 76,329,566 A197T probably benign Het
Fam227b T A 2: 126,100,909 I323L probably benign Het
Far1 G T 7: 113,554,296 probably benign Het
Fmod A G 1: 134,041,196 I325V possibly damaging Het
Gm17359 T A 3: 79,405,786 W56R probably damaging Het
Gm17660 C A 5: 104,074,881 G24* probably null Het
Gm4076 G T 13: 85,127,226 noncoding transcript Het
Gm5134 A T 10: 75,992,525 Y313F probably benign Het
H2-Q6 T A 17: 35,425,203 F54I probably damaging Het
Hcrtr2 C A 9: 76,254,672 L145F probably damaging Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Herc2 C A 7: 56,184,369 C3107* probably null Het
Herc4 T C 10: 63,264,032 V78A probably damaging Het
Hyal5 T C 6: 24,877,921 W339R probably damaging Het
Igfbp6 T A 15: 102,147,984 probably null Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Itgb4 C A 11: 115,979,695 R117S probably benign Het
Lcorl C G 5: 45,734,369 G214A probably benign Het
Lgals3bp T A 11: 118,398,193 probably null Het
Lyst T A 13: 13,616,713 L54I probably damaging Het
Mcm9 T C 10: 53,538,154 T1015A probably benign Het
Mef2d T A 3: 88,156,518 I84N probably damaging Het
Mmrn2 A G 14: 34,397,956 N261S probably damaging Het
Mpdz T C 4: 81,292,531 T1693A probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Mstn T A 1: 53,063,984 Y160N probably damaging Het
Muc6 T C 7: 141,640,468 T1431A probably benign Het
Nek9 A T 12: 85,301,883 M959K probably benign Het
Odf3l2 T C 10: 79,640,265 D155G probably damaging Het
Olfr1311 A T 2: 112,021,432 C141S probably damaging Het
Olfr319 G A 11: 58,702,243 V181I probably benign Het
Olfr911-ps1 A T 9: 38,524,505 M258L probably benign Het
Otog G T 7: 46,273,832 G1044W probably damaging Het
Pcdh9 G A 14: 93,886,235 T833M probably damaging Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pde5a A G 3: 122,748,458 N199S probably damaging Het
Plekhg1 T C 10: 3,937,971 V355A probably damaging Het
Podn G T 4: 108,021,594 L359I probably damaging Het
Psd T C 19: 46,322,161 E483G probably damaging Het
Ptch2 T A 4: 117,111,143 L905* probably null Het
Rxfp2 T A 5: 150,066,415 N420K probably damaging Het
Sde2 T A 1: 180,862,427 D237E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shc3 C T 13: 51,480,228 probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slc23a2 A G 2: 132,072,017 L280P probably damaging Het
Smchd1 G T 17: 71,387,088 Q1221K probably benign Het
Spocd1 A G 4: 129,955,470 N694S possibly damaging Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tmem131 A T 1: 36,841,673 V172D probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Usp17le T C 7: 104,768,501 N478S probably benign Het
Usp36 A G 11: 118,273,571 V205A probably damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Vwf A T 6: 125,638,114 H1176L probably benign Het
Zfyve28 C T 5: 34,232,206 D217N possibly damaging Het
Zranb3 A C 1: 127,955,080 probably null Het
Other mutations in Fshr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Fshr APN 17 88986191 missense probably damaging 1.00
IGL00272:Fshr APN 17 88985271 missense probably benign 0.00
IGL01067:Fshr APN 17 88985393 missense possibly damaging 0.95
IGL02093:Fshr APN 17 89001889 splice site probably null
IGL03184:Fshr APN 17 89046640 missense possibly damaging 0.80
IGL03383:Fshr APN 17 89046699 missense possibly damaging 0.69
IGL03383:Fshr APN 17 88985693 missense probably damaging 0.98
Absolut UTSW 17 88985342 missense possibly damaging 0.89
benedict UTSW 17 88985469 missense probably damaging 1.00
incremental UTSW 17 88985986 missense probably damaging 1.00
positively UTSW 17 88988607 missense probably damaging 1.00
R0056:Fshr UTSW 17 88988457 missense probably damaging 1.00
R0119:Fshr UTSW 17 89009285 missense probably benign 0.34
R0299:Fshr UTSW 17 89009285 missense probably benign 0.34
R0550:Fshr UTSW 17 89045125 missense probably benign 0.00
R1499:Fshr UTSW 17 88986101 missense probably damaging 1.00
R1656:Fshr UTSW 17 89200581 missense unknown
R2435:Fshr UTSW 17 89200596 missense unknown
R3730:Fshr UTSW 17 89001715 missense probably benign 0.00
R3928:Fshr UTSW 17 88985534 missense probably damaging 1.00
R4065:Fshr UTSW 17 88985966 missense probably damaging 1.00
R4625:Fshr UTSW 17 88985720 missense probably damaging 1.00
R5062:Fshr UTSW 17 88986046 nonsense probably null
R5103:Fshr UTSW 17 89097368 missense possibly damaging 0.88
R5212:Fshr UTSW 17 88986256 missense probably benign 0.00
R5212:Fshr UTSW 17 88986257 missense probably benign 0.04
R5311:Fshr UTSW 17 89011013 critical splice donor site probably null
R5456:Fshr UTSW 17 88986348 missense probably benign
R5478:Fshr UTSW 17 89001715 missense probably benign 0.00
R5577:Fshr UTSW 17 88985923 missense probably benign 0.00
R5651:Fshr UTSW 17 88985829 missense possibly damaging 0.62
R5715:Fshr UTSW 17 88986396 critical splice acceptor site probably null
R5750:Fshr UTSW 17 88986241 missense probably benign 0.01
R5797:Fshr UTSW 17 89011075 missense probably damaging 1.00
R6041:Fshr UTSW 17 88985986 missense probably damaging 1.00
R6306:Fshr UTSW 17 89200533 missense probably null 0.00
R6589:Fshr UTSW 17 88988607 missense probably damaging 1.00
R6955:Fshr UTSW 17 88985466 missense probably benign 0.00
R7080:Fshr UTSW 17 89097111 splice site probably null
R7139:Fshr UTSW 17 88986161 missense possibly damaging 0.46
R7196:Fshr UTSW 17 88985469 missense probably damaging 1.00
R7197:Fshr UTSW 17 88985469 missense probably damaging 1.00
R7289:Fshr UTSW 17 88985844 missense probably benign 0.35
R7480:Fshr UTSW 17 88985374 nonsense probably null
R7562:Fshr UTSW 17 88988497 missense probably damaging 1.00
R7710:Fshr UTSW 17 88985255 missense probably benign 0.00
R7742:Fshr UTSW 17 88986162 missense probably benign
R7821:Fshr UTSW 17 88986213 missense probably damaging 0.99
R8043:Fshr UTSW 17 88986390 missense probably benign 0.06
R8251:Fshr UTSW 17 89200485 missense probably benign 0.02
R8475:Fshr UTSW 17 88986028 missense probably damaging 1.00
R8489:Fshr UTSW 17 88986367 missense probably benign 0.00
Z1176:Fshr UTSW 17 89046667 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAGAAGCCTTGCCATGCAGTAATC -3'
(R):5'- GCCATTTGTTGCCCAAACTTTGAGC -3'

Sequencing Primer
(F):5'- ACGTGACTCCATGTTGAGATTC -3'
(R):5'- GAGCTTATCCTCTGAACAAAAACTC -3'
Posted On2013-06-12