Incidental Mutation 'R5968:Slc16a14'
ID 470683
Institutional Source Beutler Lab
Gene Symbol Slc16a14
Ensembl Gene ENSMUSG00000026220
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 14
Synonyms 1110004H10Rik
MMRRC Submission 043249-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R5968 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 84905898-84935134 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84912505 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 360 (I360V)
Ref Sequence ENSEMBL: ENSMUSP00000027422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027422]
AlphaFold Q8K1C7
Predicted Effect possibly damaging
Transcript: ENSMUST00000027422
AA Change: I360V

PolyPhen 2 Score 0.700 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027422
Gene: ENSMUSG00000026220
AA Change: I360V

DomainStartEndE-ValueType
Pfam:MFS_1 42 427 6.7e-42 PFAM
Pfam:MFS_1 419 509 7.9e-10 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,310,151 T978A probably benign Het
Adcy9 A G 16: 4,298,742 L638P probably damaging Het
Adgrf2 A G 17: 42,715,172 probably null Het
Anxa6 T C 11: 54,994,341 I461V probably damaging Het
Arap1 T C 7: 101,394,738 L668P probably damaging Het
B020031M17Rik T C 13: 119,950,082 probably benign Het
Ccdc144b T C 3: 36,010,691 Q511R probably benign Het
Ces2e G T 8: 104,932,995 G498W probably damaging Het
Crb1 A G 1: 139,243,001 C823R probably damaging Het
Ehmt1 C T 2: 24,836,457 R772H probably damaging Het
Enpep A G 3: 129,280,938 L721S probably benign Het
Flii T G 11: 60,720,212 I464L probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Ift172 T C 5: 31,261,484 E1162G probably damaging Het
Meioc A G 11: 102,675,831 S758G probably damaging Het
Ndst1 A C 18: 60,713,076 S54A probably benign Het
Ndufaf8 G T 11: 120,099,229 E56* probably null Het
Ndufb7 A G 8: 83,566,901 D28G probably benign Het
Olfr1 T C 11: 73,395,192 M277V possibly damaging Het
Olfr447 A G 6: 42,911,546 I8V probably benign Het
Prkg1 A T 19: 30,592,924 F443I probably damaging Het
Pspc1 C T 14: 56,764,236 R227H probably benign Het
Ptpn21 A G 12: 98,710,890 Y120H probably damaging Het
Runx1t1 A T 4: 13,841,890 probably null Het
Ryr3 T C 2: 112,647,049 D4449G probably benign Het
Sacs C A 14: 61,189,629 A159E probably damaging Het
Thop1 A G 10: 81,075,559 D93G probably benign Het
Tmem92 A C 11: 94,778,738 M85R probably benign Het
Ttn T C 2: 76,857,673 probably benign Het
Zdhhc5 T C 2: 84,694,375 probably null Het
Zfp335 T C 2: 164,892,394 H1291R probably damaging Het
Zfp957 C T 14: 79,214,056 C101Y probably damaging Het
Other mutations in Slc16a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slc16a14 APN 1 84922871 missense probably damaging 0.99
IGL01563:Slc16a14 APN 1 84912187 splice site probably benign
R0315:Slc16a14 UTSW 1 84912496 missense possibly damaging 0.46
R0380:Slc16a14 UTSW 1 84929530 missense possibly damaging 0.72
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1837:Slc16a14 UTSW 1 84912399 missense probably benign 0.02
R2149:Slc16a14 UTSW 1 84907399 missense probably damaging 1.00
R2293:Slc16a14 UTSW 1 84912843 missense probably benign
R3790:Slc16a14 UTSW 1 84929280 unclassified probably benign
R4016:Slc16a14 UTSW 1 84912507 nonsense probably null
R4596:Slc16a14 UTSW 1 84929357 missense probably damaging 1.00
R4637:Slc16a14 UTSW 1 84907282 missense possibly damaging 0.86
R4723:Slc16a14 UTSW 1 84913020 missense probably damaging 1.00
R5137:Slc16a14 UTSW 1 84912597 missense probably damaging 1.00
R5262:Slc16a14 UTSW 1 84912891 missense probably benign 0.00
R5410:Slc16a14 UTSW 1 84907424 missense probably damaging 0.98
R5927:Slc16a14 UTSW 1 84912267 missense possibly damaging 0.91
R6052:Slc16a14 UTSW 1 84912709 missense possibly damaging 0.75
R6264:Slc16a14 UTSW 1 84907409 missense probably benign 0.30
R6290:Slc16a14 UTSW 1 84907385 missense probably benign 0.10
R7383:Slc16a14 UTSW 1 84912571 missense probably damaging 1.00
R7390:Slc16a14 UTSW 1 84929466 missense probably benign 0.25
R7535:Slc16a14 UTSW 1 84913122 missense probably damaging 1.00
R8326:Slc16a14 UTSW 1 84912345 missense possibly damaging 0.94
R8669:Slc16a14 UTSW 1 84922884 missense probably benign 0.00
R8784:Slc16a14 UTSW 1 84913063 missense probably benign 0.01
R9409:Slc16a14 UTSW 1 84929395 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATTAGGGCACAAATGACAGCC -3'
(R):5'- GTTCTGAAGACAGTGAGCCAG -3'

Sequencing Primer
(F):5'- ATGACAGCCAGACTCGCGTAG -3'
(R):5'- AGCTCACTGTGCAAGTCC -3'
Posted On 2017-03-31