Mutagenetix > Incidental Mutations

Incidental Mutation 'R5968:Gtf2h3'

470696

Institutional Source

Beutler Lab

Gene Symbol

Gtf2h3

Ensembl Gene

ENSMUSG00000029387

Gene Name

general transcription factor IIH, polypeptide 3

Synonyms

34kDa, BTF2, D5Ertd679e, 5033417D07Rik

MMRRC Submission

043249-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.949) question?

Stock #

R5968 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124579140-124597680 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 124584297 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 121 (T121I)

Ref Sequence

ENSEMBL: ENSMUSP00000031333 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031333]

AlphaFold

Q8VD76

Predicted Effect

probably benign
Transcript: ENSMUST00000031333
AA Change: T121I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000031333
Gene: ENSMUSG00000029387
AA Change: T121I

Domain	Start	End	E-Value	Type
Pfam:Tfb4	8	287	2.1e-108	PFAM
low complexity region	299	306	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126466

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153436

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200670

Meta Mutation Damage Score

0.0598

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TFB4 family. The encoded protein is a subunit of the core-TFIIH basal transcription factor and localizes to the nucleus. The encoded protein is involved in RNA transcription by RNA polymerase II and nucleotide excision repair and associates with the Cdk-activating kinase complex. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 14. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	T	C	17: 46,310,151	T978A	probably benign	Het
Adcy9	A	G	16: 4,298,742	L638P	probably damaging	Het
Adgrf2	A	G	17: 42,715,172		probably null	Het
Anxa6	T	C	11: 54,994,341	I461V	probably damaging	Het
Arap1	T	C	7: 101,394,738	L668P	probably damaging	Het
B020031M17Rik	T	C	13: 119,950,082		probably benign	Het
Ccdc144b	T	C	3: 36,010,691	Q511R	probably benign	Het
Ces2e	G	T	8: 104,932,995	G498W	probably damaging	Het
Crb1	A	G	1: 139,243,001	C823R	probably damaging	Het
Ehmt1	C	T	2: 24,836,457	R772H	probably damaging	Het
Enpep	A	G	3: 129,280,938	L721S	probably benign	Het
Flii	T	G	11: 60,720,212	I464L	probably benign	Het
Ift172	T	C	5: 31,261,484	E1162G	probably damaging	Het
Meioc	A	G	11: 102,675,831	S758G	probably damaging	Het
Ndst1	A	C	18: 60,713,076	S54A	probably benign	Het
Ndufaf8	G	T	11: 120,099,229	E56*	probably null	Het
Ndufb7	A	G	8: 83,566,901	D28G	probably benign	Het
Olfr1	T	C	11: 73,395,192	M277V	possibly damaging	Het
Olfr447	A	G	6: 42,911,546	I8V	probably benign	Het
Prkg1	A	T	19: 30,592,924	F443I	probably damaging	Het
Pspc1	C	T	14: 56,764,236	R227H	probably benign	Het
Ptpn21	A	G	12: 98,710,890	Y120H	probably damaging	Het
Runx1t1	A	T	4: 13,841,890		probably null	Het
Ryr3	T	C	2: 112,647,049	D4449G	probably benign	Het
Sacs	C	A	14: 61,189,629	A159E	probably damaging	Het
Slc16a14	T	C	1: 84,912,505	I360V	possibly damaging	Het
Thop1	A	G	10: 81,075,559	D93G	probably benign	Het
Tmem92	A	C	11: 94,778,738	M85R	probably benign	Het
Ttn	T	C	2: 76,857,673		probably benign	Het
Zdhhc5	T	C	2: 84,694,375		probably null	Het
Zfp335	T	C	2: 164,892,394	H1291R	probably damaging	Het
Zfp957	C	T	14: 79,214,056	C101Y	probably damaging	Het

Other mutations in Gtf2h3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01118:Gtf2h3	APN	5	124595668	missense	probably damaging	0.96
IGL01611:Gtf2h3	APN	5	124595685	missense	probably damaging	1.00
IGL01681:Gtf2h3	APN	5	124594791	missense	probably damaging	1.00
IGL03097:Gtf2h3	UTSW	5	124602168	unclassified	probably benign
R0599:Gtf2h3	UTSW	5	124588628	missense	probably benign	0.00
R1512:Gtf2h3	UTSW	5	124590870	missense	probably damaging	0.99
R1727:Gtf2h3	UTSW	5	124590356	missense	probably benign	0.00
R1880:Gtf2h3	UTSW	5	124584273	missense	probably benign	0.00
R1881:Gtf2h3	UTSW	5	124584273	missense	probably benign	0.00
R1929:Gtf2h3	UTSW	5	124602199	unclassified	probably benign
R2149:Gtf2h3	UTSW	5	124599785	unclassified	probably benign
R2359:Gtf2h3	UTSW	5	124590876	missense	probably damaging	1.00
R2993:Gtf2h3	UTSW	5	124583934	missense	probably benign	0.00
R4399:Gtf2h3	UTSW	5	124602063	unclassified	probably benign
R4551:Gtf2h3	UTSW	5	124590419	intron	probably benign
R5282:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R5289:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R5566:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R5567:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R5569:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R5570:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R5581:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R5583:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R5709:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R5784:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R5967:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R6036:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R6050:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R6518:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R6519:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R6520:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R6526:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R6528:Gtf2h3	UTSW	5	124584297	missense	probably benign	0.00
R7176:Gtf2h3	UTSW	5	124590370	missense	probably damaging	0.99
R7184:Gtf2h3	UTSW	5	124584004	missense	probably benign	0.22
R8262:Gtf2h3	UTSW	5	124590904	nonsense	probably null
R8270:Gtf2h3	UTSW	5	124595987	makesense	probably null
R8323:Gtf2h3	UTSW	5	124582471	missense	probably benign	0.01
R8361:Gtf2h3	UTSW	5	124595668	missense	probably damaging	0.96
R8736:Gtf2h3	UTSW	5	124590909	missense	probably damaging	1.00
Z1176:Gtf2h3	UTSW	5	124579175	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- CCCCTCAGCCGGCTCTTATA -3'
(R):5'- ACAAAGCTGGGAGGCATGTA -3'

Sequencing Primer
(F):5'- CTCTTATACCCGGGGAAGAACG -3'
(R):5'- CTGGGAGGCATGTAGGGAG -3'

Posted On

2017-03-31