Incidental Mutation 'R5968:Gtf2h3'
ID 470696
Institutional Source Beutler Lab
Gene Symbol Gtf2h3
Ensembl Gene ENSMUSG00000029387
Gene Name general transcription factor IIH, polypeptide 3
Synonyms 34kDa, BTF2, D5Ertd679e, 5033417D07Rik
MMRRC Submission 043249-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock # R5968 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 124579140-124597680 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 124584297 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 121 (T121I)
Ref Sequence ENSEMBL: ENSMUSP00000031333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031333]
AlphaFold Q8VD76
Predicted Effect probably benign
Transcript: ENSMUST00000031333
AA Change: T121I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000031333
Gene: ENSMUSG00000029387
AA Change: T121I

DomainStartEndE-ValueType
Pfam:Tfb4 8 287 2.1e-108 PFAM
low complexity region 299 306 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200670
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TFB4 family. The encoded protein is a subunit of the core-TFIIH basal transcription factor and localizes to the nucleus. The encoded protein is involved in RNA transcription by RNA polymerase II and nucleotide excision repair and associates with the Cdk-activating kinase complex. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 14. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,310,151 T978A probably benign Het
Adcy9 A G 16: 4,298,742 L638P probably damaging Het
Adgrf2 A G 17: 42,715,172 probably null Het
Anxa6 T C 11: 54,994,341 I461V probably damaging Het
Arap1 T C 7: 101,394,738 L668P probably damaging Het
B020031M17Rik T C 13: 119,950,082 probably benign Het
Ccdc144b T C 3: 36,010,691 Q511R probably benign Het
Ces2e G T 8: 104,932,995 G498W probably damaging Het
Crb1 A G 1: 139,243,001 C823R probably damaging Het
Ehmt1 C T 2: 24,836,457 R772H probably damaging Het
Enpep A G 3: 129,280,938 L721S probably benign Het
Flii T G 11: 60,720,212 I464L probably benign Het
Ift172 T C 5: 31,261,484 E1162G probably damaging Het
Meioc A G 11: 102,675,831 S758G probably damaging Het
Ndst1 A C 18: 60,713,076 S54A probably benign Het
Ndufaf8 G T 11: 120,099,229 E56* probably null Het
Ndufb7 A G 8: 83,566,901 D28G probably benign Het
Olfr1 T C 11: 73,395,192 M277V possibly damaging Het
Olfr447 A G 6: 42,911,546 I8V probably benign Het
Prkg1 A T 19: 30,592,924 F443I probably damaging Het
Pspc1 C T 14: 56,764,236 R227H probably benign Het
Ptpn21 A G 12: 98,710,890 Y120H probably damaging Het
Runx1t1 A T 4: 13,841,890 probably null Het
Ryr3 T C 2: 112,647,049 D4449G probably benign Het
Sacs C A 14: 61,189,629 A159E probably damaging Het
Slc16a14 T C 1: 84,912,505 I360V possibly damaging Het
Thop1 A G 10: 81,075,559 D93G probably benign Het
Tmem92 A C 11: 94,778,738 M85R probably benign Het
Ttn T C 2: 76,857,673 probably benign Het
Zdhhc5 T C 2: 84,694,375 probably null Het
Zfp335 T C 2: 164,892,394 H1291R probably damaging Het
Zfp957 C T 14: 79,214,056 C101Y probably damaging Het
Other mutations in Gtf2h3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Gtf2h3 APN 5 124595668 missense probably damaging 0.96
IGL01611:Gtf2h3 APN 5 124595685 missense probably damaging 1.00
IGL01681:Gtf2h3 APN 5 124594791 missense probably damaging 1.00
IGL03097:Gtf2h3 UTSW 5 124602168 unclassified probably benign
R0599:Gtf2h3 UTSW 5 124588628 missense probably benign 0.00
R1512:Gtf2h3 UTSW 5 124590870 missense probably damaging 0.99
R1727:Gtf2h3 UTSW 5 124590356 missense probably benign 0.00
R1880:Gtf2h3 UTSW 5 124584273 missense probably benign 0.00
R1881:Gtf2h3 UTSW 5 124584273 missense probably benign 0.00
R1929:Gtf2h3 UTSW 5 124602199 unclassified probably benign
R2149:Gtf2h3 UTSW 5 124599785 unclassified probably benign
R2359:Gtf2h3 UTSW 5 124590876 missense probably damaging 1.00
R2993:Gtf2h3 UTSW 5 124583934 missense probably benign 0.00
R4399:Gtf2h3 UTSW 5 124602063 unclassified probably benign
R4551:Gtf2h3 UTSW 5 124590419 intron probably benign
R5282:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5289:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5566:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5567:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5569:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5570:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5581:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5583:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5709:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5784:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R5967:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6036:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6050:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6518:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6519:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6520:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6526:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R6528:Gtf2h3 UTSW 5 124584297 missense probably benign 0.00
R7176:Gtf2h3 UTSW 5 124590370 missense probably damaging 0.99
R7184:Gtf2h3 UTSW 5 124584004 missense probably benign 0.22
R8262:Gtf2h3 UTSW 5 124590904 nonsense probably null
R8270:Gtf2h3 UTSW 5 124595987 makesense probably null
R8323:Gtf2h3 UTSW 5 124582471 missense probably benign 0.01
R8361:Gtf2h3 UTSW 5 124595668 missense probably damaging 0.96
R8736:Gtf2h3 UTSW 5 124590909 missense probably damaging 1.00
Z1176:Gtf2h3 UTSW 5 124579175 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCCCTCAGCCGGCTCTTATA -3'
(R):5'- ACAAAGCTGGGAGGCATGTA -3'

Sequencing Primer
(F):5'- CTCTTATACCCGGGGAAGAACG -3'
(R):5'- CTGGGAGGCATGTAGGGAG -3'
Posted On 2017-03-31