Incidental Mutation 'R5968:Meioc'
ID 470705
Institutional Source Beutler Lab
Gene Symbol Meioc
Ensembl Gene ENSMUSG00000051455
Gene Name meiosis specific with coiled-coil domain
Synonyms Gm1564, LOC380729, LOC268491
MMRRC Submission 043249-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock # R5968 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 102663716-102682237 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102675831 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 758 (S758G)
Ref Sequence ENSEMBL: ENSMUSP00000097947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100378] [ENSMUST00000156590]
AlphaFold A2AG06
Predicted Effect probably damaging
Transcript: ENSMUST00000100378
AA Change: S758G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097947
Gene: ENSMUSG00000051455
AA Change: S758G

DomainStartEndE-ValueType
low complexity region 526 537 N/A INTRINSIC
low complexity region 712 728 N/A INTRINSIC
Pfam:DUF4582 757 922 5.1e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155813
Predicted Effect probably benign
Transcript: ENSMUST00000156590
SMART Domains Protein: ENSMUSP00000116246
Gene: ENSMUSG00000051455

DomainStartEndE-ValueType
low complexity region 470 481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit infertility with small gonads, absent germ cells and arrested meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,310,151 T978A probably benign Het
Adcy9 A G 16: 4,298,742 L638P probably damaging Het
Adgrf2 A G 17: 42,715,172 probably null Het
Anxa6 T C 11: 54,994,341 I461V probably damaging Het
Arap1 T C 7: 101,394,738 L668P probably damaging Het
B020031M17Rik T C 13: 119,950,082 probably benign Het
Ccdc144b T C 3: 36,010,691 Q511R probably benign Het
Ces2e G T 8: 104,932,995 G498W probably damaging Het
Crb1 A G 1: 139,243,001 C823R probably damaging Het
Ehmt1 C T 2: 24,836,457 R772H probably damaging Het
Enpep A G 3: 129,280,938 L721S probably benign Het
Flii T G 11: 60,720,212 I464L probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Ift172 T C 5: 31,261,484 E1162G probably damaging Het
Ndst1 A C 18: 60,713,076 S54A probably benign Het
Ndufaf8 G T 11: 120,099,229 E56* probably null Het
Ndufb7 A G 8: 83,566,901 D28G probably benign Het
Olfr1 T C 11: 73,395,192 M277V possibly damaging Het
Olfr447 A G 6: 42,911,546 I8V probably benign Het
Prkg1 A T 19: 30,592,924 F443I probably damaging Het
Pspc1 C T 14: 56,764,236 R227H probably benign Het
Ptpn21 A G 12: 98,710,890 Y120H probably damaging Het
Runx1t1 A T 4: 13,841,890 probably null Het
Ryr3 T C 2: 112,647,049 D4449G probably benign Het
Sacs C A 14: 61,189,629 A159E probably damaging Het
Slc16a14 T C 1: 84,912,505 I360V possibly damaging Het
Thop1 A G 10: 81,075,559 D93G probably benign Het
Tmem92 A C 11: 94,778,738 M85R probably benign Het
Ttn T C 2: 76,857,673 probably benign Het
Zdhhc5 T C 2: 84,694,375 probably null Het
Zfp335 T C 2: 164,892,394 H1291R probably damaging Het
Zfp957 C T 14: 79,214,056 C101Y probably damaging Het
Other mutations in Meioc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Meioc APN 11 102674287 missense probably benign 0.33
IGL01952:Meioc APN 11 102672185 missense possibly damaging 0.79
IGL02006:Meioc APN 11 102674266 missense probably damaging 1.00
IGL02195:Meioc APN 11 102674857 missense possibly damaging 0.91
IGL02339:Meioc APN 11 102668448 missense probably benign 0.18
IGL02935:Meioc APN 11 102672191 missense probably benign 0.06
IGL03294:Meioc APN 11 102680669 missense probably damaging 1.00
PIT4519001:Meioc UTSW 11 102679957 missense probably damaging 1.00
R0285:Meioc UTSW 11 102672191 missense probably benign 0.06
R0964:Meioc UTSW 11 102680031 missense probably damaging 1.00
R1074:Meioc UTSW 11 102675393 missense probably damaging 1.00
R2024:Meioc UTSW 11 102675358 missense probably benign 0.00
R4012:Meioc UTSW 11 102675828 missense probably damaging 0.99
R4429:Meioc UTSW 11 102675720 missense probably damaging 1.00
R4491:Meioc UTSW 11 102674920 missense possibly damaging 0.84
R4594:Meioc UTSW 11 102674166 missense probably damaging 1.00
R4752:Meioc UTSW 11 102674433 missense probably benign 0.00
R5301:Meioc UTSW 11 102680045 missense probably damaging 1.00
R5352:Meioc UTSW 11 102675313 missense probably benign 0.03
R5646:Meioc UTSW 11 102675257 missense possibly damaging 0.94
R5958:Meioc UTSW 11 102675153 missense probably benign 0.41
R6157:Meioc UTSW 11 102668401 missense probably damaging 1.00
R6410:Meioc UTSW 11 102675034 missense probably benign 0.00
R6644:Meioc UTSW 11 102668460 critical splice donor site probably null
R7285:Meioc UTSW 11 102666342 missense probably benign 0.00
R7440:Meioc UTSW 11 102674237 missense possibly damaging 0.67
R7815:Meioc UTSW 11 102675588 missense probably damaging 1.00
R7984:Meioc UTSW 11 102674606 missense possibly damaging 0.94
R8009:Meioc UTSW 11 102676743 missense probably damaging 1.00
R8078:Meioc UTSW 11 102668400 nonsense probably null
R8195:Meioc UTSW 11 102675067 nonsense probably null
R8429:Meioc UTSW 11 102674206 missense probably benign 0.06
R8797:Meioc UTSW 11 102676860 nonsense probably null
R8854:Meioc UTSW 11 102675763 missense probably damaging 0.98
R8891:Meioc UTSW 11 102668420 missense probably benign 0.43
R9081:Meioc UTSW 11 102674175 missense probably benign 0.00
R9360:Meioc UTSW 11 102674953 missense probably benign 0.13
Z1177:Meioc UTSW 11 102666364 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGATCTACCCACCCATTTGG -3'
(R):5'- CCTACTTAAGTCCTTTATAGCATTGAA -3'

Sequencing Primer
(F):5'- GGCCATTCAGTTGTTCCACTG -3'
(R):5'- CAGAGCTATTCAGAGAAGTCCTGTC -3'
Posted On 2017-03-31