Incidental Mutation 'R5968:Ndst1'
ID470716
Institutional Source Beutler Lab
Gene Symbol Ndst1
Ensembl Gene ENSMUSG00000054008
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonymsglucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik
MMRRC Submission 043249-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5968 (G1)
Quality Score163
Status Not validated
Chromosome18
Chromosomal Location60685978-60713389 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 60713076 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 54 (S54A)
Ref Sequence ENSEMBL: ENSMUSP00000126623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169273]
Predicted Effect probably benign
Transcript: ENSMUST00000169273
AA Change: S54A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: S54A

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:HSNSD 25 515 5.1e-254 PFAM
Pfam:Sulfotransfer_1 604 869 2.2e-48 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,310,151 T978A probably benign Het
Adcy9 A G 16: 4,298,742 L638P probably damaging Het
Adgrf2 A G 17: 42,715,172 probably null Het
Anxa6 T C 11: 54,994,341 I461V probably damaging Het
Arap1 T C 7: 101,394,738 L668P probably damaging Het
B020031M17Rik T C 13: 119,950,082 probably benign Het
Ccdc144b T C 3: 36,010,691 Q511R probably benign Het
Ces2e G T 8: 104,932,995 G498W probably damaging Het
Crb1 A G 1: 139,243,001 C823R probably damaging Het
Ehmt1 C T 2: 24,836,457 R772H probably damaging Het
Enpep A G 3: 129,280,938 L721S probably benign Het
Flii T G 11: 60,720,212 I464L probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Ift172 T C 5: 31,261,484 E1162G probably damaging Het
Meioc A G 11: 102,675,831 S758G probably damaging Het
Ndufaf8 G T 11: 120,099,229 E56* probably null Het
Ndufb7 A G 8: 83,566,901 D28G probably benign Het
Olfr1 T C 11: 73,395,192 M277V possibly damaging Het
Olfr447 A G 6: 42,911,546 I8V probably benign Het
Prkg1 A T 19: 30,592,924 F443I probably damaging Het
Pspc1 C T 14: 56,764,236 R227H probably benign Het
Ptpn21 A G 12: 98,710,890 Y120H probably damaging Het
Runx1t1 A T 4: 13,841,890 probably null Het
Ryr3 T C 2: 112,647,049 D4449G probably benign Het
Sacs C A 14: 61,189,629 A159E probably damaging Het
Slc16a14 T C 1: 84,912,505 I360V possibly damaging Het
Thop1 A G 10: 81,075,559 D93G probably benign Het
Tmem92 A C 11: 94,778,738 M85R probably benign Het
Ttn T C 2: 76,857,673 probably benign Het
Zdhhc5 T C 2: 84,694,375 probably null Het
Zfp335 T C 2: 164,892,394 H1291R probably damaging Het
Zfp957 C T 14: 79,214,056 C101Y probably damaging Het
Other mutations in Ndst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Ndst1 APN 18 60707956 missense probably damaging 1.00
IGL01410:Ndst1 APN 18 60700445 missense probably damaging 1.00
IGL01578:Ndst1 APN 18 60713126 missense probably damaging 1.00
IGL02133:Ndst1 APN 18 60699546 missense probably benign 0.05
IGL03200:Ndst1 APN 18 60699539 missense possibly damaging 0.86
R0631:Ndst1 UTSW 18 60700359 splice site probably benign
R0899:Ndst1 UTSW 18 60707882 missense probably benign 0.00
R1104:Ndst1 UTSW 18 60697146 missense probably damaging 0.98
R1371:Ndst1 UTSW 18 60707647 missense possibly damaging 0.90
R1456:Ndst1 UTSW 18 60713205 missense possibly damaging 0.73
R1511:Ndst1 UTSW 18 60697170 missense possibly damaging 0.61
R1524:Ndst1 UTSW 18 60698504 missense probably damaging 0.99
R1699:Ndst1 UTSW 18 60695508 missense probably damaging 1.00
R1718:Ndst1 UTSW 18 60707803 missense probably damaging 0.99
R1772:Ndst1 UTSW 18 60702837 missense probably damaging 0.99
R1900:Ndst1 UTSW 18 60712721 critical splice donor site probably null
R2079:Ndst1 UTSW 18 60695509 missense probably damaging 1.00
R2105:Ndst1 UTSW 18 60691253 missense probably benign 0.01
R2127:Ndst1 UTSW 18 60691208 missense probably benign 0.00
R2875:Ndst1 UTSW 18 60690047 missense probably damaging 1.00
R3798:Ndst1 UTSW 18 60713166 missense possibly damaging 0.94
R3950:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3951:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R3952:Ndst1 UTSW 18 60697139 missense probably benign 0.12
R4868:Ndst1 UTSW 18 60695476 missense probably benign 0.07
R4898:Ndst1 UTSW 18 60691987 missense probably benign 0.12
R4988:Ndst1 UTSW 18 60702933 missense probably damaging 0.99
R5271:Ndst1 UTSW 18 60705132 missense probably benign 0.03
R5337:Ndst1 UTSW 18 60690007 missense probably damaging 1.00
R5467:Ndst1 UTSW 18 60692021 missense probably benign
R5830:Ndst1 UTSW 18 60703838 missense probably damaging 1.00
R6241:Ndst1 UTSW 18 60703829 missense probably damaging 0.99
R6422:Ndst1 UTSW 18 60702953 missense probably benign 0.44
R7099:Ndst1 UTSW 18 60695500 missense possibly damaging 0.88
R7544:Ndst1 UTSW 18 60697184 missense probably damaging 1.00
V8831:Ndst1 UTSW 18 60702927 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTATTTGAAGCGACTGGATTCC -3'
(R):5'- CAGTGGACAGCTTTTGGGAC -3'

Sequencing Primer
(F):5'- TGGATTCCAGGATTGCCAC -3'
(R):5'- GATTGAGATCTTGGGATCCAGAATGC -3'
Posted On2017-03-31