Mutagenetix > Incidental Mutations

Incidental Mutation 'R5968:Ndst1'

470716

Institutional Source

Beutler Lab

Gene Symbol

Ndst1

Ensembl Gene

ENSMUSG00000054008

Gene Name

N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1

Synonyms

glucosaminyl N-deacetylase/N-sulfotransferase 1, b2b2230Clo, Hsst, Ndst-1, 1200015G06Rik

MMRRC Submission

043249-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5968 (G1)

Quality Score

163

Status

Not validated

Chromosome

Chromosomal Location

60685978-60713389 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 60713076 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 54 (S54A)

Ref Sequence

ENSEMBL: ENSMUSP00000126623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169273]

Predicted Effect

probably benign
Transcript: ENSMUST00000169273
AA Change: S54A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126623
Gene: ENSMUSG00000054008
AA Change: S54A

Domain	Start	End	E-Value	Type
low complexity region	3	12	N/A	INTRINSIC
Pfam:HSNSD	25	515	5.1e-254	PFAM
Pfam:Sulfotransfer_1	604	869	2.2e-48	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. The encoded protein catalyzes the transfer of sulfate from 3'-phosphoadenosine 5'-phosphosulfate to nitrogen of glucosamine in heparan sulfate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die late in gestation or neonatally. Lungs fail to inflate and mice born alive experience respiratory distress and failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	T	C	17: 46,310,151	T978A	probably benign	Het
Adcy9	A	G	16: 4,298,742	L638P	probably damaging	Het
Adgrf2	A	G	17: 42,715,172		probably null	Het
Anxa6	T	C	11: 54,994,341	I461V	probably damaging	Het
Arap1	T	C	7: 101,394,738	L668P	probably damaging	Het
B020031M17Rik	T	C	13: 119,950,082		probably benign	Het
Ccdc144b	T	C	3: 36,010,691	Q511R	probably benign	Het
Ces2e	G	T	8: 104,932,995	G498W	probably damaging	Het
Crb1	A	G	1: 139,243,001	C823R	probably damaging	Het
Ehmt1	C	T	2: 24,836,457	R772H	probably damaging	Het
Enpep	A	G	3: 129,280,938	L721S	probably benign	Het
Flii	T	G	11: 60,720,212	I464L	probably benign	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Ift172	T	C	5: 31,261,484	E1162G	probably damaging	Het
Meioc	A	G	11: 102,675,831	S758G	probably damaging	Het
Ndufaf8	G	T	11: 120,099,229	E56*	probably null	Het
Ndufb7	A	G	8: 83,566,901	D28G	probably benign	Het
Olfr1	T	C	11: 73,395,192	M277V	possibly damaging	Het
Olfr447	A	G	6: 42,911,546	I8V	probably benign	Het
Prkg1	A	T	19: 30,592,924	F443I	probably damaging	Het
Pspc1	C	T	14: 56,764,236	R227H	probably benign	Het
Ptpn21	A	G	12: 98,710,890	Y120H	probably damaging	Het
Runx1t1	A	T	4: 13,841,890		probably null	Het
Ryr3	T	C	2: 112,647,049	D4449G	probably benign	Het
Sacs	C	A	14: 61,189,629	A159E	probably damaging	Het
Slc16a14	T	C	1: 84,912,505	I360V	possibly damaging	Het
Thop1	A	G	10: 81,075,559	D93G	probably benign	Het
Tmem92	A	C	11: 94,778,738	M85R	probably benign	Het
Ttn	T	C	2: 76,857,673		probably benign	Het
Zdhhc5	T	C	2: 84,694,375		probably null	Het
Zfp335	T	C	2: 164,892,394	H1291R	probably damaging	Het
Zfp957	C	T	14: 79,214,056	C101Y	probably damaging	Het

Other mutations in Ndst1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Ndst1	APN	18	60707956	missense	probably damaging	1.00
IGL01410:Ndst1	APN	18	60700445	missense	probably damaging	1.00
IGL01578:Ndst1	APN	18	60713126	missense	probably damaging	1.00
IGL02133:Ndst1	APN	18	60699546	missense	probably benign	0.05
IGL03200:Ndst1	APN	18	60699539	missense	possibly damaging	0.86
R0631:Ndst1	UTSW	18	60700359	splice site	probably benign
R0899:Ndst1	UTSW	18	60707882	missense	probably benign	0.00
R1104:Ndst1	UTSW	18	60697146	missense	probably damaging	0.98
R1371:Ndst1	UTSW	18	60707647	missense	possibly damaging	0.90
R1456:Ndst1	UTSW	18	60713205	missense	possibly damaging	0.73
R1511:Ndst1	UTSW	18	60697170	missense	possibly damaging	0.61
R1524:Ndst1	UTSW	18	60698504	missense	probably damaging	0.99
R1699:Ndst1	UTSW	18	60695508	missense	probably damaging	1.00
R1718:Ndst1	UTSW	18	60707803	missense	probably damaging	0.99
R1772:Ndst1	UTSW	18	60702837	missense	probably damaging	0.99
R1900:Ndst1	UTSW	18	60712721	critical splice donor site	probably null
R2079:Ndst1	UTSW	18	60695509	missense	probably damaging	1.00
R2105:Ndst1	UTSW	18	60691253	missense	probably benign	0.01
R2127:Ndst1	UTSW	18	60691208	missense	probably benign	0.00
R2875:Ndst1	UTSW	18	60690047	missense	probably damaging	1.00
R3798:Ndst1	UTSW	18	60713166	missense	possibly damaging	0.94
R3950:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3951:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R3952:Ndst1	UTSW	18	60697139	missense	probably benign	0.12
R4868:Ndst1	UTSW	18	60695476	missense	probably benign	0.07
R4898:Ndst1	UTSW	18	60691987	missense	probably benign	0.12
R4988:Ndst1	UTSW	18	60702933	missense	probably damaging	0.99
R5271:Ndst1	UTSW	18	60705132	missense	probably benign	0.03
R5337:Ndst1	UTSW	18	60690007	missense	probably damaging	1.00
R5467:Ndst1	UTSW	18	60692021	missense	probably benign
R5830:Ndst1	UTSW	18	60703838	missense	probably damaging	1.00
R6241:Ndst1	UTSW	18	60703829	missense	probably damaging	0.99
R6422:Ndst1	UTSW	18	60702953	missense	probably benign	0.44
R7099:Ndst1	UTSW	18	60695500	missense	possibly damaging	0.88
R7544:Ndst1	UTSW	18	60697184	missense	probably damaging	1.00
V8831:Ndst1	UTSW	18	60702927	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTATTTGAAGCGACTGGATTCC -3'
(R):5'- CAGTGGACAGCTTTTGGGAC -3'

Sequencing Primer
(F):5'- TGGATTCCAGGATTGCCAC -3'
(R):5'- GATTGAGATCTTGGGATCCAGAATGC -3'

Posted On

2017-03-31