Incidental Mutation 'R5968:Prkg1'
ID470718
Institutional Source Beutler Lab
Gene Symbol Prkg1
Ensembl Gene ENSMUSG00000052920
Gene Nameprotein kinase, cGMP-dependent, type I
SynonymsPrkgr1b, Prkg1b
MMRRC Submission 043249-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R5968 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location30567551-31765033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30592924 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 443 (F443I)
Ref Sequence ENSEMBL: ENSMUSP00000073268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065067] [ENSMUST00000073581]
Predicted Effect probably damaging
Transcript: ENSMUST00000065067
AA Change: F428I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067576
Gene: ENSMUSG00000052920
AA Change: F428I

DomainStartEndE-ValueType
coiled coil region 5 49 N/A INTRINSIC
cNMP 103 216 6.37e-27 SMART
cNMP 221 343 1.23e-33 SMART
S_TKc 360 619 5.25e-91 SMART
S_TK_X 620 671 1.55e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073581
AA Change: F443I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073268
Gene: ENSMUSG00000052920
AA Change: F443I

DomainStartEndE-ValueType
coiled coil region 10 62 N/A INTRINSIC
cNMP 118 231 6.37e-27 SMART
cNMP 236 358 1.23e-33 SMART
S_TKc 375 634 5.25e-91 SMART
S_TK_X 635 686 1.55e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice exhibit abnormal smooth muscle function and penile erectile deficiency. Conditional disruption in the hippocampus results in impaired LTP. Mice homozygous for a transposon induced allele exhibit postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,310,151 T978A probably benign Het
Adcy9 A G 16: 4,298,742 L638P probably damaging Het
Adgrf2 A G 17: 42,715,172 probably null Het
Anxa6 T C 11: 54,994,341 I461V probably damaging Het
Arap1 T C 7: 101,394,738 L668P probably damaging Het
B020031M17Rik T C 13: 119,950,082 probably benign Het
Ccdc144b T C 3: 36,010,691 Q511R probably benign Het
Ces2e G T 8: 104,932,995 G498W probably damaging Het
Crb1 A G 1: 139,243,001 C823R probably damaging Het
Ehmt1 C T 2: 24,836,457 R772H probably damaging Het
Enpep A G 3: 129,280,938 L721S probably benign Het
Flii T G 11: 60,720,212 I464L probably benign Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Ift172 T C 5: 31,261,484 E1162G probably damaging Het
Meioc A G 11: 102,675,831 S758G probably damaging Het
Ndst1 A C 18: 60,713,076 S54A probably benign Het
Ndufaf8 G T 11: 120,099,229 E56* probably null Het
Ndufb7 A G 8: 83,566,901 D28G probably benign Het
Olfr1 T C 11: 73,395,192 M277V possibly damaging Het
Olfr447 A G 6: 42,911,546 I8V probably benign Het
Pspc1 C T 14: 56,764,236 R227H probably benign Het
Ptpn21 A G 12: 98,710,890 Y120H probably damaging Het
Runx1t1 A T 4: 13,841,890 probably null Het
Ryr3 T C 2: 112,647,049 D4449G probably benign Het
Sacs C A 14: 61,189,629 A159E probably damaging Het
Slc16a14 T C 1: 84,912,505 I360V possibly damaging Het
Thop1 A G 10: 81,075,559 D93G probably benign Het
Tmem92 A C 11: 94,778,738 M85R probably benign Het
Ttn T C 2: 76,857,673 probably benign Het
Zdhhc5 T C 2: 84,694,375 probably null Het
Zfp335 T C 2: 164,892,394 H1291R probably damaging Het
Zfp957 C T 14: 79,214,056 C101Y probably damaging Het
Other mutations in Prkg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Prkg1 APN 19 31302340 missense probably benign 0.02
IGL00481:Prkg1 APN 19 30571622 missense probably benign 0.28
IGL00517:Prkg1 APN 19 30894668 missense probably benign
IGL00782:Prkg1 APN 19 30578753 splice site probably benign
IGL01070:Prkg1 APN 19 30569343 splice site probably benign
IGL01106:Prkg1 APN 19 30585278 missense probably benign 0.05
IGL01783:Prkg1 APN 19 30624689 missense probably damaging 1.00
IGL02135:Prkg1 APN 19 30993076 missense probably benign 0.13
IGL02492:Prkg1 APN 19 30724202 missense probably damaging 1.00
IGL02543:Prkg1 APN 19 30624734 missense possibly damaging 0.62
IGL02733:Prkg1 APN 19 31302301 missense probably damaging 1.00
IGL03129:Prkg1 APN 19 30585281 nonsense probably null
IGL03220:Prkg1 APN 19 30569237 utr 3 prime probably benign
R0363:Prkg1 UTSW 19 31664196 missense probably damaging 1.00
R0693:Prkg1 UTSW 19 30594978 missense probably benign
R1099:Prkg1 UTSW 19 30571612 missense probably benign
R1464:Prkg1 UTSW 19 30578870 missense probably damaging 0.99
R1464:Prkg1 UTSW 19 30578870 missense probably damaging 0.99
R1556:Prkg1 UTSW 19 30624743 missense probably benign
R1738:Prkg1 UTSW 19 30786922 missense possibly damaging 0.48
R1974:Prkg1 UTSW 19 31585695 missense probably damaging 1.00
R2011:Prkg1 UTSW 19 31664142 missense possibly damaging 0.94
R2207:Prkg1 UTSW 19 30578860 missense probably damaging 1.00
R2270:Prkg1 UTSW 19 30578631 missense probably benign 0.27
R3009:Prkg1 UTSW 19 31664112 missense possibly damaging 0.74
R4078:Prkg1 UTSW 19 31585578 missense probably damaging 1.00
R4355:Prkg1 UTSW 19 30569229 utr 3 prime probably benign
R4652:Prkg1 UTSW 19 30595012 missense probably damaging 1.00
R4669:Prkg1 UTSW 19 31664239 missense probably damaging 0.98
R4684:Prkg1 UTSW 19 31664179 nonsense probably null
R4789:Prkg1 UTSW 19 31585645 missense probably damaging 0.97
R4826:Prkg1 UTSW 19 31764606 missense possibly damaging 0.93
R4936:Prkg1 UTSW 19 30586375 missense probably benign 0.37
R5625:Prkg1 UTSW 19 31764762 missense possibly damaging 0.95
R5819:Prkg1 UTSW 19 31585672 missense probably benign 0.02
R5855:Prkg1 UTSW 19 30894694 missense possibly damaging 0.93
R5882:Prkg1 UTSW 19 31585697 missense probably damaging 1.00
R5965:Prkg1 UTSW 19 30724156 splice site probably null
R6310:Prkg1 UTSW 19 30569251 missense probably damaging 1.00
R6433:Prkg1 UTSW 19 30781346 missense probably benign 0.21
R6702:Prkg1 UTSW 19 30993084 missense probably benign 0.00
R6750:Prkg1 UTSW 19 31764561 missense probably benign 0.41
R6894:Prkg1 UTSW 19 30624774 nonsense probably null
R7155:Prkg1 UTSW 19 31302301 missense probably damaging 1.00
R7165:Prkg1 UTSW 19 30585199 missense probably damaging 1.00
R7238:Prkg1 UTSW 19 30624690 missense probably damaging 1.00
R7428:Prkg1 UTSW 19 30578835 missense probably damaging 1.00
R7748:Prkg1 UTSW 19 30993091 missense possibly damaging 0.90
R7804:Prkg1 UTSW 19 30578632 missense probably benign 0.00
R7804:Prkg1 UTSW 19 30624770 missense possibly damaging 0.92
R7893:Prkg1 UTSW 19 30586367 missense probably damaging 0.99
R8304:Prkg1 UTSW 19 30724184 missense possibly damaging 0.75
X0011:Prkg1 UTSW 19 30993121 missense probably damaging 1.00
Z1177:Prkg1 UTSW 19 31302373 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGTCATTGTATGTGCGCTTACA -3'
(R):5'- ATGTGCTTAATACTCTGGTTTAACTT -3'

Sequencing Primer
(F):5'- ATGTGCGCTTACAATGGATTC -3'
(R):5'- CTCTGCTACATATGCAGCTGGAG -3'
Posted On2017-03-31