Incidental Mutation 'R5969:Snx16'
ID470729
Institutional Source Beutler Lab
Gene Symbol Snx16
Ensembl Gene ENSMUSG00000027534
Gene Namesorting nexin 16
Synonyms4930522N22Rik
MMRRC Submission 044152-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5969 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location10417817-10440102 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10438157 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 10 (M10K)
Ref Sequence ENSEMBL: ENSMUSP00000141230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029047] [ENSMUST00000099223] [ENSMUST00000195822]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029047
AA Change: M10K

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029047
Gene: ENSMUSG00000027534
AA Change: M10K

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
PX 110 214 1.65e-17 SMART
coiled coil region 230 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099223
AA Change: M10K

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096828
Gene: ENSMUSG00000027534
AA Change: M10K

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
PX 110 214 1.65e-17 SMART
coiled coil region 230 274 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195822
AA Change: M10K

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141230
Gene: ENSMUSG00000027534
AA Change: M10K

DomainStartEndE-ValueType
low complexity region 27 40 N/A INTRINSIC
Blast:PX 105 134 2e-6 BLAST
Meta Mutation Damage Score 0.2267 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. The protein encoded by this gene associates with late endosome membranes as is involved in tubule formation, cholesterol transport, and transport of tetraspanin CD81. The encoded protein also inhibits cell migration and tumorigenesis. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A C 15: 102,350,564 Y19D probably damaging Het
Abca13 T A 11: 9,292,214 L1359* probably null Het
Ahi1 A T 10: 20,984,393 D671V probably damaging Het
Ahnak T C 19: 9,016,585 S5078P probably damaging Het
Ankhd1 A T 18: 36,600,834 T584S probably damaging Het
Apba2 T A 7: 64,744,447 L568* probably null Het
Cenpn C A 8: 116,940,537 L300I probably damaging Het
Cmya5 A T 13: 93,089,544 L3012Q possibly damaging Het
Cnnm1 T C 19: 43,491,472 S819P probably damaging Het
Cpa6 A T 1: 10,488,883 S87T probably benign Het
Crybg2 T A 4: 134,075,692 probably null Het
Csmd1 T A 8: 16,071,353 T1777S probably benign Het
Csmd3 G T 15: 47,947,990 P1235Q probably damaging Het
Cxcr4 T A 1: 128,589,847 N24Y probably benign Het
D630003M21Rik G T 2: 158,217,708 H91N probably damaging Het
Ece1 T C 4: 137,961,740 probably null Het
Edc3 T C 9: 57,713,428 S11P probably damaging Het
Exoc3 G A 13: 74,172,186 Q719* probably null Het
Fam13a A G 6: 58,965,198 M203T probably damaging Het
Fam160b1 C T 19: 57,384,123 R602* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fxyd2 T A 9: 45,408,330 I30N probably damaging Het
Gapt A G 13: 110,353,946 V61A probably benign Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gm2035 T C 12: 87,919,478 D127G unknown Het
Gpr35 T C 1: 92,983,220 V2A probably damaging Het
Gtf3c1 A G 7: 125,645,676 S1729P possibly damaging Het
Heatr5a T C 12: 51,959,040 T51A probably benign Het
Kat6b G A 14: 21,670,792 M1737I probably damaging Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klk10 A G 7: 43,784,985 Y267C probably damaging Het
Lgmn T C 12: 102,405,827 Y98C probably damaging Het
Lyst A C 13: 13,687,813 probably null Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mfng A T 15: 78,764,382 V165D possibly damaging Het
Mto1 A G 9: 78,452,905 E225G probably damaging Het
Notch3 C A 17: 32,153,884 C571F probably damaging Het
Nup205 C T 6: 35,177,578 probably benign Het
Olfr65 T A 7: 103,906,910 I157N probably damaging Het
P2ry14 T A 3: 59,115,158 I303F probably damaging Het
Pcnx3 T C 19: 5,685,535 D421G probably damaging Het
Pdlim4 T C 11: 54,063,656 H75R possibly damaging Het
Phf21a A T 2: 92,221,611 H17L probably damaging Het
Ppid T A 3: 79,597,717 N122K probably damaging Het
Ppp4r3a T C 12: 101,043,579 I613V probably benign Het
Prcp C T 7: 92,917,766 P229S probably benign Het
Ralgds T C 2: 28,542,414 V85A probably damaging Het
Rgs22 G A 15: 36,015,636 T1034I probably benign Het
Slc4a3 T C 1: 75,549,979 V48A probably damaging Het
Svep1 G A 4: 58,070,977 Q2270* probably null Het
Tmem185b T G 1: 119,527,463 I318S probably benign Het
Tnik C T 3: 28,620,948 R657C probably damaging Het
Top3b T C 16: 16,883,565 probably null Het
Trim40 C T 17: 36,882,427 R203H probably benign Het
Triobp T A 15: 78,967,540 N631K probably benign Het
Ubr3 T G 2: 69,979,386 Y1233* probably null Het
Vgll3 A G 16: 65,839,563 D200G probably damaging Het
Vmn2r24 G A 6: 123,779,022 E18K probably benign Het
Zfp141 C A 7: 42,489,488 R40L probably damaging Het
Other mutations in Snx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Snx16 APN 3 10419159 missense probably damaging 1.00
IGL02682:Snx16 APN 3 10438175 missense probably damaging 1.00
R0539:Snx16 UTSW 3 10426218 missense probably damaging 0.98
R1469:Snx16 UTSW 3 10434371 missense probably damaging 1.00
R1469:Snx16 UTSW 3 10434371 missense probably damaging 1.00
R1771:Snx16 UTSW 3 10419161 missense probably damaging 1.00
R5262:Snx16 UTSW 3 10437832 missense probably damaging 1.00
R5693:Snx16 UTSW 3 10420258 missense probably benign 0.00
R5964:Snx16 UTSW 3 10434481 missense possibly damaging 0.92
R6826:Snx16 UTSW 3 10438088 missense probably damaging 0.99
R7456:Snx16 UTSW 3 10435481 nonsense probably null
R7996:Snx16 UTSW 3 10435449 missense probably benign 0.11
R8095:Snx16 UTSW 3 10438184 start codon destroyed probably null 1.00
R8880:Snx16 UTSW 3 10419133 missense probably benign 0.01
Z1177:Snx16 UTSW 3 10420858 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGATGATGCACTGTCCATCTG -3'
(R):5'- CCCATGTCTTCATAGGTAATTGAGTG -3'

Sequencing Primer
(F):5'- GATCCTGGACATTCGTCTGCTTAAG -3'
(R):5'- TTGAGTGTCACAAATTAAGAGAAGC -3'
Posted On2017-03-31