Incidental Mutation 'R5969:Ahi1'
ID470751
Institutional Source Beutler Lab
Gene Symbol Ahi1
Ensembl Gene ENSMUSG00000019986
Gene NameAbelson helper integration site 1
Synonyms1700015F03Rik, Jouberin, D10Bwg0629e, Ahi-1
MMRRC Submission 044152-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R5969 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location20952547-21080429 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20984393 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 671 (D671V)
Ref Sequence ENSEMBL: ENSMUSP00000149010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105525] [ENSMUST00000213104]
Predicted Effect probably damaging
Transcript: ENSMUST00000105525
AA Change: D671V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101164
Gene: ENSMUSG00000019986
AA Change: D671V

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 85 106 N/A INTRINSIC
low complexity region 148 159 N/A INTRINSIC
WD40 448 490 4.3e-1 SMART
WD40 493 532 9.3e-9 SMART
WD40 537 576 2.48e-4 SMART
WD40 583 622 6.09e-4 SMART
WD40 641 678 1.9e2 SMART
WD40 684 721 3.98e0 SMART
WD40 724 769 9.51e1 SMART
SH3 905 961 2.15e-21 SMART
low complexity region 975 989 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000213104
AA Change: D671V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9402 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is apparently required for both cerebellar and cortical development in humans. This gene mutations cause specific forms of Joubert syndrome-related disorders. Joubert syndrome (JS) is a recessively inherited developmental brain disorder with several identified causative chromosomal loci. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mouse embryonic fibroblasts homozygous for one knock-out allele exhibit reduced and abnormal cilia. Mice homozygous for another knock-out allele exhibit premature death and abnormal kidney morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A C 15: 102,350,564 Y19D probably damaging Het
Abca13 T A 11: 9,292,214 L1359* probably null Het
Ahnak T C 19: 9,016,585 S5078P probably damaging Het
Ankhd1 A T 18: 36,600,834 T584S probably damaging Het
Apba2 T A 7: 64,744,447 L568* probably null Het
Cenpn C A 8: 116,940,537 L300I probably damaging Het
Cmya5 A T 13: 93,089,544 L3012Q possibly damaging Het
Cnnm1 T C 19: 43,491,472 S819P probably damaging Het
Cpa6 A T 1: 10,488,883 S87T probably benign Het
Crybg2 T A 4: 134,075,692 probably null Het
Csmd1 T A 8: 16,071,353 T1777S probably benign Het
Csmd3 G T 15: 47,947,990 P1235Q probably damaging Het
Cxcr4 T A 1: 128,589,847 N24Y probably benign Het
D630003M21Rik G T 2: 158,217,708 H91N probably damaging Het
Ece1 T C 4: 137,961,740 probably null Het
Edc3 T C 9: 57,713,428 S11P probably damaging Het
Exoc3 G A 13: 74,172,186 Q719* probably null Het
Fam13a A G 6: 58,965,198 M203T probably damaging Het
Fam160b1 C T 19: 57,384,123 R602* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fxyd2 T A 9: 45,408,330 I30N probably damaging Het
Gapt A G 13: 110,353,946 V61A probably benign Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gm2035 T C 12: 87,919,478 D127G unknown Het
Gpr35 T C 1: 92,983,220 V2A probably damaging Het
Gtf3c1 A G 7: 125,645,676 S1729P possibly damaging Het
Heatr5a T C 12: 51,959,040 T51A probably benign Het
Kat6b G A 14: 21,670,792 M1737I probably damaging Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klk10 A G 7: 43,784,985 Y267C probably damaging Het
Lgmn T C 12: 102,405,827 Y98C probably damaging Het
Lyst A C 13: 13,687,813 probably null Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mfng A T 15: 78,764,382 V165D possibly damaging Het
Mto1 A G 9: 78,452,905 E225G probably damaging Het
Notch3 C A 17: 32,153,884 C571F probably damaging Het
Nup205 C T 6: 35,177,578 probably benign Het
Olfr65 T A 7: 103,906,910 I157N probably damaging Het
P2ry14 T A 3: 59,115,158 I303F probably damaging Het
Pcnx3 T C 19: 5,685,535 D421G probably damaging Het
Pdlim4 T C 11: 54,063,656 H75R possibly damaging Het
Phf21a A T 2: 92,221,611 H17L probably damaging Het
Ppid T A 3: 79,597,717 N122K probably damaging Het
Ppp4r3a T C 12: 101,043,579 I613V probably benign Het
Prcp C T 7: 92,917,766 P229S probably benign Het
Ralgds T C 2: 28,542,414 V85A probably damaging Het
Rgs22 G A 15: 36,015,636 T1034I probably benign Het
Slc4a3 T C 1: 75,549,979 V48A probably damaging Het
Snx16 A T 3: 10,438,157 M10K possibly damaging Het
Svep1 G A 4: 58,070,977 Q2270* probably null Het
Tmem185b T G 1: 119,527,463 I318S probably benign Het
Tnik C T 3: 28,620,948 R657C probably damaging Het
Top3b T C 16: 16,883,565 probably null Het
Trim40 C T 17: 36,882,427 R203H probably benign Het
Triobp T A 15: 78,967,540 N631K probably benign Het
Ubr3 T G 2: 69,979,386 Y1233* probably null Het
Vgll3 A G 16: 65,839,563 D200G probably damaging Het
Vmn2r24 G A 6: 123,779,022 E18K probably benign Het
Zfp141 C A 7: 42,489,488 R40L probably damaging Het
Other mutations in Ahi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ahi1 APN 10 20972141 missense probably damaging 1.00
IGL00914:Ahi1 APN 10 20984299 splice site probably null
IGL01075:Ahi1 APN 10 20987025 missense possibly damaging 0.80
IGL01094:Ahi1 APN 10 20972060 missense probably damaging 0.99
IGL01128:Ahi1 APN 10 21074433 missense probably benign
IGL01527:Ahi1 APN 10 20960085 splice site probably benign
IGL01821:Ahi1 APN 10 21041243 critical splice donor site probably null
IGL02159:Ahi1 APN 10 21058177 missense probably benign 0.13
IGL02176:Ahi1 APN 10 20970916 missense probably benign 0.00
IGL02200:Ahi1 APN 10 20981314 splice site probably benign
IGL02232:Ahi1 APN 10 20981375 missense probably damaging 1.00
IGL02305:Ahi1 APN 10 20970897 missense probably benign 0.00
IGL02323:Ahi1 APN 10 20972034 missense probably damaging 1.00
IGL02885:Ahi1 APN 10 21055113 missense possibly damaging 0.61
IGL02958:Ahi1 APN 10 20963799 missense probably damaging 1.00
IGL02971:Ahi1 APN 10 21000551 missense possibly damaging 0.93
IGL03109:Ahi1 APN 10 20970942 missense probably benign 0.00
IGL03192:Ahi1 APN 10 20965635 missense probably benign 0.00
IGL03377:Ahi1 APN 10 21018004 missense possibly damaging 0.51
arisen UTSW 10 21007768 missense possibly damaging 0.53
urspringt UTSW 10 20984393 missense probably damaging 1.00
P4717OSA:Ahi1 UTSW 10 20972110 missense probably damaging 1.00
P4748:Ahi1 UTSW 10 20972110 missense probably damaging 1.00
R0448:Ahi1 UTSW 10 20972075 missense probably damaging 1.00
R0559:Ahi1 UTSW 10 21000719 splice site probably benign
R0627:Ahi1 UTSW 10 20965522 missense probably benign 0.10
R0652:Ahi1 UTSW 10 20979461 missense probably damaging 1.00
R0690:Ahi1 UTSW 10 20970843 splice site probably benign
R1209:Ahi1 UTSW 10 20963730 missense probably damaging 0.98
R1364:Ahi1 UTSW 10 20972156 missense probably damaging 0.97
R1510:Ahi1 UTSW 10 20959800 missense probably benign 0.00
R1634:Ahi1 UTSW 10 20965693 missense probably damaging 1.00
R1789:Ahi1 UTSW 10 20963115 missense probably benign 0.18
R1818:Ahi1 UTSW 10 20988562 missense probably damaging 1.00
R2069:Ahi1 UTSW 10 20959996 missense probably damaging 0.98
R2148:Ahi1 UTSW 10 20970976 missense possibly damaging 0.64
R2566:Ahi1 UTSW 10 20970911 nonsense probably null
R2850:Ahi1 UTSW 10 21000593 missense probably benign 0.07
R2862:Ahi1 UTSW 10 20981408 missense probably damaging 0.99
R3969:Ahi1 UTSW 10 20959947 missense probably damaging 1.00
R4430:Ahi1 UTSW 10 20972078 missense probably damaging 1.00
R4496:Ahi1 UTSW 10 20965545 missense probably benign 0.07
R4755:Ahi1 UTSW 10 21055047 missense possibly damaging 0.94
R4916:Ahi1 UTSW 10 20984404 missense probably damaging 1.00
R5216:Ahi1 UTSW 10 20960076 missense probably benign 0.00
R5223:Ahi1 UTSW 10 20970919 missense possibly damaging 0.79
R5224:Ahi1 UTSW 10 20987022 missense probably damaging 1.00
R5604:Ahi1 UTSW 10 20987005 missense probably damaging 1.00
R5665:Ahi1 UTSW 10 21055047 missense possibly damaging 0.94
R5704:Ahi1 UTSW 10 21074427 missense probably benign
R5769:Ahi1 UTSW 10 20960082 critical splice donor site probably null
R5899:Ahi1 UTSW 10 21000566 missense probably benign 0.06
R5936:Ahi1 UTSW 10 20965933 missense probably damaging 1.00
R6066:Ahi1 UTSW 10 20959926 missense possibly damaging 0.84
R6122:Ahi1 UTSW 10 21058165 missense probably benign 0.26
R6135:Ahi1 UTSW 10 20969121 missense probably benign 0.01
R6240:Ahi1 UTSW 10 20977081 missense probably damaging 1.00
R6387:Ahi1 UTSW 10 20969043 missense probably damaging 1.00
R6395:Ahi1 UTSW 10 20979592 missense possibly damaging 0.49
R6406:Ahi1 UTSW 10 20977049 missense probably damaging 1.00
R6440:Ahi1 UTSW 10 20960082 critical splice donor site probably benign
R6558:Ahi1 UTSW 10 20963673 missense probably damaging 1.00
R6744:Ahi1 UTSW 10 20965567 missense probably damaging 1.00
R6755:Ahi1 UTSW 10 21017913 missense probably damaging 0.98
R6927:Ahi1 UTSW 10 21055069 missense probably damaging 1.00
R6932:Ahi1 UTSW 10 20963691 missense probably benign 0.02
R6967:Ahi1 UTSW 10 20988625 missense probably damaging 0.98
R7168:Ahi1 UTSW 10 21017932 missense probably benign 0.01
R7169:Ahi1 UTSW 10 21055019 missense probably damaging 1.00
R7327:Ahi1 UTSW 10 20987077 missense probably damaging 0.99
R7351:Ahi1 UTSW 10 20965933 missense probably damaging 1.00
R7489:Ahi1 UTSW 10 20963750 missense probably benign 0.35
R7680:Ahi1 UTSW 10 21007768 missense possibly damaging 0.53
R7878:Ahi1 UTSW 10 20981431 critical splice donor site probably null
R7999:Ahi1 UTSW 10 20965681 missense probably benign 0.31
R8219:Ahi1 UTSW 10 21074436 missense probably benign 0.00
R8248:Ahi1 UTSW 10 20972092 missense probably benign 0.04
R8560:Ahi1 UTSW 10 20959915 missense probably benign 0.04
X0024:Ahi1 UTSW 10 21000592 missense possibly damaging 0.69
Z1177:Ahi1 UTSW 10 21041007 intron probably benign
Predicted Primers PCR Primer
(F):5'- TAGGTCAGGCTCTGCTCTCAAC -3'
(R):5'- GACTGTCACTCATCAGACGTAAG -3'

Sequencing Primer
(F):5'- TGCTCTCAACGAGAAGCG -3'
(R):5'- TCATCAGACGTAAGCAGCAG -3'
Posted On2017-03-31