Incidental Mutation 'R5969:Heatr5a'
ID470754
Institutional Source Beutler Lab
Gene Symbol Heatr5a
Ensembl Gene ENSMUSG00000035181
Gene NameHEAT repeat containing 5A
SynonymsD930036F22Rik
MMRRC Submission 044152-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R5969 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location51875871-51971321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51959040 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 51 (T51A)
Ref Sequence ENSEMBL: ENSMUSP00000043115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040583]
Predicted Effect probably benign
Transcript: ENSMUST00000040583
AA Change: T51A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043115
Gene: ENSMUSG00000035181
AA Change: T51A

DomainStartEndE-ValueType
low complexity region 56 67 N/A INTRINSIC
SCOP:d1qbkb_ 112 658 6e-13 SMART
low complexity region 1063 1078 N/A INTRINSIC
low complexity region 1081 1095 N/A INTRINSIC
low complexity region 1110 1120 N/A INTRINSIC
low complexity region 1122 1135 N/A INTRINSIC
low complexity region 1496 1507 N/A INTRINSIC
low complexity region 1722 1735 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218254
Meta Mutation Damage Score 0.0609 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A C 15: 102,350,564 Y19D probably damaging Het
Abca13 T A 11: 9,292,214 L1359* probably null Het
Ahi1 A T 10: 20,984,393 D671V probably damaging Het
Ahnak T C 19: 9,016,585 S5078P probably damaging Het
Ankhd1 A T 18: 36,600,834 T584S probably damaging Het
Apba2 T A 7: 64,744,447 L568* probably null Het
Cenpn C A 8: 116,940,537 L300I probably damaging Het
Cmya5 A T 13: 93,089,544 L3012Q possibly damaging Het
Cnnm1 T C 19: 43,491,472 S819P probably damaging Het
Cpa6 A T 1: 10,488,883 S87T probably benign Het
Crybg2 T A 4: 134,075,692 probably null Het
Csmd1 T A 8: 16,071,353 T1777S probably benign Het
Csmd3 G T 15: 47,947,990 P1235Q probably damaging Het
Cxcr4 T A 1: 128,589,847 N24Y probably benign Het
D630003M21Rik G T 2: 158,217,708 H91N probably damaging Het
Ece1 T C 4: 137,961,740 probably null Het
Edc3 T C 9: 57,713,428 S11P probably damaging Het
Exoc3 G A 13: 74,172,186 Q719* probably null Het
Fam13a A G 6: 58,965,198 M203T probably damaging Het
Fam160b1 C T 19: 57,384,123 R602* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fxyd2 T A 9: 45,408,330 I30N probably damaging Het
Gapt A G 13: 110,353,946 V61A probably benign Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gm2035 T C 12: 87,919,478 D127G unknown Het
Gpr35 T C 1: 92,983,220 V2A probably damaging Het
Gtf3c1 A G 7: 125,645,676 S1729P possibly damaging Het
Kat6b G A 14: 21,670,792 M1737I probably damaging Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klk10 A G 7: 43,784,985 Y267C probably damaging Het
Lgmn T C 12: 102,405,827 Y98C probably damaging Het
Lyst A C 13: 13,687,813 probably null Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mfng A T 15: 78,764,382 V165D possibly damaging Het
Mto1 A G 9: 78,452,905 E225G probably damaging Het
Notch3 C A 17: 32,153,884 C571F probably damaging Het
Nup205 C T 6: 35,177,578 probably benign Het
Olfr65 T A 7: 103,906,910 I157N probably damaging Het
P2ry14 T A 3: 59,115,158 I303F probably damaging Het
Pcnx3 T C 19: 5,685,535 D421G probably damaging Het
Pdlim4 T C 11: 54,063,656 H75R possibly damaging Het
Phf21a A T 2: 92,221,611 H17L probably damaging Het
Ppid T A 3: 79,597,717 N122K probably damaging Het
Ppp4r3a T C 12: 101,043,579 I613V probably benign Het
Prcp C T 7: 92,917,766 P229S probably benign Het
Ralgds T C 2: 28,542,414 V85A probably damaging Het
Rgs22 G A 15: 36,015,636 T1034I probably benign Het
Slc4a3 T C 1: 75,549,979 V48A probably damaging Het
Snx16 A T 3: 10,438,157 M10K possibly damaging Het
Svep1 G A 4: 58,070,977 Q2270* probably null Het
Tmem185b T G 1: 119,527,463 I318S probably benign Het
Tnik C T 3: 28,620,948 R657C probably damaging Het
Top3b T C 16: 16,883,565 probably null Het
Trim40 C T 17: 36,882,427 R203H probably benign Het
Triobp T A 15: 78,967,540 N631K probably benign Het
Ubr3 T G 2: 69,979,386 Y1233* probably null Het
Vgll3 A G 16: 65,839,563 D200G probably damaging Het
Vmn2r24 G A 6: 123,779,022 E18K probably benign Het
Zfp141 C A 7: 42,489,488 R40L probably damaging Het
Other mutations in Heatr5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Heatr5a APN 12 51888901 missense probably damaging 0.99
IGL01397:Heatr5a APN 12 51894369 missense possibly damaging 0.89
IGL01481:Heatr5a APN 12 51955425 missense probably damaging 1.00
IGL01684:Heatr5a APN 12 51955511 missense probably benign 0.36
IGL01766:Heatr5a APN 12 51889664 missense probably benign 0.15
IGL01799:Heatr5a APN 12 51897835 missense probably benign 0.17
IGL02007:Heatr5a APN 12 51916158 missense probably damaging 1.00
IGL02093:Heatr5a APN 12 51916075 missense possibly damaging 0.68
IGL02205:Heatr5a APN 12 51877337 missense probably damaging 1.00
IGL02450:Heatr5a APN 12 51945430 missense probably benign 0.02
IGL02565:Heatr5a APN 12 51951099 missense possibly damaging 0.54
IGL02707:Heatr5a APN 12 51921366 missense probably benign 0.01
IGL02735:Heatr5a APN 12 51915021 missense probably damaging 0.99
IGL03160:Heatr5a APN 12 51884496 splice site probably benign
F5770:Heatr5a UTSW 12 51881278 splice site probably benign
R0034:Heatr5a UTSW 12 51925172 missense probably damaging 1.00
R0127:Heatr5a UTSW 12 51925405 missense probably benign
R0184:Heatr5a UTSW 12 51909969 missense probably benign 0.00
R0362:Heatr5a UTSW 12 51888861 missense probably damaging 1.00
R0567:Heatr5a UTSW 12 51910089 missense probably damaging 1.00
R0591:Heatr5a UTSW 12 51910101 splice site probably benign
R0736:Heatr5a UTSW 12 51896561 critical splice donor site probably null
R1532:Heatr5a UTSW 12 51952518 missense probably damaging 0.99
R1914:Heatr5a UTSW 12 51905467 missense probably damaging 1.00
R1956:Heatr5a UTSW 12 51945419 critical splice donor site probably null
R1978:Heatr5a UTSW 12 51939658 missense possibly damaging 0.77
R2044:Heatr5a UTSW 12 51955403 missense probably benign 0.19
R2263:Heatr5a UTSW 12 51916150 missense probably damaging 0.97
R2265:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2267:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2268:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2269:Heatr5a UTSW 12 51893745 missense possibly damaging 0.68
R2842:Heatr5a UTSW 12 51955478 missense probably null 1.00
R2842:Heatr5a UTSW 12 51955477 synonymous probably null
R3033:Heatr5a UTSW 12 51951038 nonsense probably null
R4303:Heatr5a UTSW 12 51956225 missense probably benign 0.01
R4675:Heatr5a UTSW 12 51877347 missense probably benign 0.17
R4718:Heatr5a UTSW 12 51916163 missense possibly damaging 0.95
R4807:Heatr5a UTSW 12 51877520 missense probably damaging 1.00
R5114:Heatr5a UTSW 12 51956237 nonsense probably null
R5229:Heatr5a UTSW 12 51947978 missense probably benign 0.33
R5411:Heatr5a UTSW 12 51888243 missense probably damaging 1.00
R5548:Heatr5a UTSW 12 51958951 nonsense probably null
R5603:Heatr5a UTSW 12 51877575 missense probably benign 0.26
R5631:Heatr5a UTSW 12 51955527 missense probably benign 0.22
R5742:Heatr5a UTSW 12 51955552 nonsense probably null
R6020:Heatr5a UTSW 12 51884327 missense probably benign 0.01
R6234:Heatr5a UTSW 12 51877454 missense possibly damaging 0.69
R6352:Heatr5a UTSW 12 51951166 missense possibly damaging 0.88
R6798:Heatr5a UTSW 12 51881265 missense probably benign 0.01
R6815:Heatr5a UTSW 12 51955508 missense possibly damaging 0.89
R7059:Heatr5a UTSW 12 51888234 missense probably damaging 0.98
R7143:Heatr5a UTSW 12 51961468 missense probably benign 0.09
R7178:Heatr5a UTSW 12 51925142 missense probably damaging 0.99
R7291:Heatr5a UTSW 12 51925339 missense probably damaging 0.97
R7454:Heatr5a UTSW 12 51961543 missense probably benign 0.20
R7511:Heatr5a UTSW 12 51879434 missense possibly damaging 0.94
R7636:Heatr5a UTSW 12 51888196 missense probably damaging 1.00
R7636:Heatr5a UTSW 12 51952558 missense probably damaging 1.00
R7665:Heatr5a UTSW 12 51961530 missense probably damaging 1.00
V7732:Heatr5a UTSW 12 51905324 missense possibly damaging 0.65
Z1088:Heatr5a UTSW 12 51891404 missense probably damaging 1.00
Z1088:Heatr5a UTSW 12 51951076 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- TACAGTTTGGTGGGAAGGTAAC -3'
(R):5'- TCTCTGCTAATGGACTGAAGTG -3'

Sequencing Primer
(F):5'- AACTTGGAGAGTCATCTTTGCTC -3'
(R):5'- AGAGCTTCCTTTTAGTGACAGC -3'
Posted On2017-03-31