Incidental Mutation 'R5969:Gm2035'
ID470755
Institutional Source Beutler Lab
Gene Symbol Gm2035
Ensembl Gene ENSMUSG00000096619
Gene Namepredicted pseudogene 2035
Synonyms
MMRRC Submission 044152-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R5969 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location87919423-87919857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87919478 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 127 (D127G)
Ref Sequence ENSEMBL: ENSMUSP00000137146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180053]
Predicted Effect unknown
Transcript: ENSMUST00000180053
AA Change: D127G
SMART Domains Protein: ENSMUSP00000137146
Gene: ENSMUSG00000096619
AA Change: D127G

DomainStartEndE-ValueType
low complexity region 3 25 N/A INTRINSIC
eIF1a 28 110 4.13e-45 SMART
low complexity region 125 144 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A C 15: 102,350,564 Y19D probably damaging Het
Abca13 T A 11: 9,292,214 L1359* probably null Het
Ahi1 A T 10: 20,984,393 D671V probably damaging Het
Ahnak T C 19: 9,016,585 S5078P probably damaging Het
Ankhd1 A T 18: 36,600,834 T584S probably damaging Het
Apba2 T A 7: 64,744,447 L568* probably null Het
Cenpn C A 8: 116,940,537 L300I probably damaging Het
Cmya5 A T 13: 93,089,544 L3012Q possibly damaging Het
Cnnm1 T C 19: 43,491,472 S819P probably damaging Het
Cpa6 A T 1: 10,488,883 S87T probably benign Het
Crybg2 T A 4: 134,075,692 probably null Het
Csmd1 T A 8: 16,071,353 T1777S probably benign Het
Csmd3 G T 15: 47,947,990 P1235Q probably damaging Het
Cxcr4 T A 1: 128,589,847 N24Y probably benign Het
D630003M21Rik G T 2: 158,217,708 H91N probably damaging Het
Ece1 T C 4: 137,961,740 probably null Het
Edc3 T C 9: 57,713,428 S11P probably damaging Het
Exoc3 G A 13: 74,172,186 Q719* probably null Het
Fam13a A G 6: 58,965,198 M203T probably damaging Het
Fam160b1 C T 19: 57,384,123 R602* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fxyd2 T A 9: 45,408,330 I30N probably damaging Het
Gapt A G 13: 110,353,946 V61A probably benign Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gpr35 T C 1: 92,983,220 V2A probably damaging Het
Gtf3c1 A G 7: 125,645,676 S1729P possibly damaging Het
Heatr5a T C 12: 51,959,040 T51A probably benign Het
Kat6b G A 14: 21,670,792 M1737I probably damaging Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klk10 A G 7: 43,784,985 Y267C probably damaging Het
Lgmn T C 12: 102,405,827 Y98C probably damaging Het
Lyst A C 13: 13,687,813 probably null Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mfng A T 15: 78,764,382 V165D possibly damaging Het
Mto1 A G 9: 78,452,905 E225G probably damaging Het
Notch3 C A 17: 32,153,884 C571F probably damaging Het
Nup205 C T 6: 35,177,578 probably benign Het
Olfr65 T A 7: 103,906,910 I157N probably damaging Het
P2ry14 T A 3: 59,115,158 I303F probably damaging Het
Pcnx3 T C 19: 5,685,535 D421G probably damaging Het
Pdlim4 T C 11: 54,063,656 H75R possibly damaging Het
Phf21a A T 2: 92,221,611 H17L probably damaging Het
Ppid T A 3: 79,597,717 N122K probably damaging Het
Ppp4r3a T C 12: 101,043,579 I613V probably benign Het
Prcp C T 7: 92,917,766 P229S probably benign Het
Ralgds T C 2: 28,542,414 V85A probably damaging Het
Rgs22 G A 15: 36,015,636 T1034I probably benign Het
Slc4a3 T C 1: 75,549,979 V48A probably damaging Het
Snx16 A T 3: 10,438,157 M10K possibly damaging Het
Svep1 G A 4: 58,070,977 Q2270* probably null Het
Tmem185b T G 1: 119,527,463 I318S probably benign Het
Tnik C T 3: 28,620,948 R657C probably damaging Het
Top3b T C 16: 16,883,565 probably null Het
Trim40 C T 17: 36,882,427 R203H probably benign Het
Triobp T A 15: 78,967,540 N631K probably benign Het
Ubr3 T G 2: 69,979,386 Y1233* probably null Het
Vgll3 A G 16: 65,839,563 D200G probably damaging Het
Vmn2r24 G A 6: 123,779,022 E18K probably benign Het
Zfp141 C A 7: 42,489,488 R40L probably damaging Het
Other mutations in Gm2035
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02314:Gm2035 APN 12 87919607 missense probably benign 0.00
IGL02347:Gm2035 APN 12 87919589 missense probably damaging 1.00
IGL02639:Gm2035 APN 12 87919499 missense probably benign 0.04
R4230:Gm2035 UTSW 12 87919797 missense unknown
R6159:Gm2035 UTSW 12 87919751 missense probably damaging 1.00
R6359:Gm2035 UTSW 12 87919505 missense probably benign 0.09
R7181:Gm2035 UTSW 12 87919722 missense possibly damaging 0.49
R7183:Gm2035 UTSW 12 87919722 missense possibly damaging 0.49
R7184:Gm2035 UTSW 12 87919722 missense possibly damaging 0.49
R7653:Gm2035 UTSW 12 87919478 missense unknown
R8046:Gm2035 UTSW 12 87919565 missense probably benign 0.02
R8353:Gm2035 UTSW 12 87919553 missense probably benign
R8453:Gm2035 UTSW 12 87919553 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCATTGACAAGACACACTCATG -3'
(R):5'- CCAAAATGCTGGGATGTGGAC -3'

Sequencing Primer
(F):5'- CACACTCATGCCAAATGAAGTTTTAC -3'
(R):5'- TGTAAGGAGGCTGTGCAAC -3'
Posted On2017-03-31