Incidental Mutation 'R5969:Lgmn'
ID470757
Institutional Source Beutler Lab
Gene Symbol Lgmn
Ensembl Gene ENSMUSG00000021190
Gene Namelegumain
SynonymsPrsc1, preprolegumain, AEP
MMRRC Submission 044152-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5969 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location102394084-102439813 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102405827 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 98 (Y98C)
Ref Sequence ENSEMBL: ENSMUSP00000105647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021607] [ENSMUST00000110020]
Predicted Effect probably damaging
Transcript: ENSMUST00000021607
AA Change: Y98C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021607
Gene: ENSMUSG00000021190
AA Change: Y98C

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110020
AA Change: Y98C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105647
Gene: ENSMUSG00000021190
AA Change: Y98C

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Peptidase_C13 31 288 8e-120 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146499
Meta Mutation Damage Score 0.9614 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: This gene encodes a member of the cysteine peptidase family C13 that plays an important role in the endosome/lysosomal degradation system. The encoded inactive preproprotein undergoes autocatalytic removal of the C-terminal inhibitory propeptide to generate the active endopeptidase that cleaves protein substrates on the C-terminal side of asparagine residues. Mice lacking the encoded protein exhibit defects in the lysosomal processing of proteins resulting in their accumulation in the lysosomes, and develop symptoms resembling hemophagocytic lymphohistiocytosis. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a null allele exhibit slow postnatal weight gain, develop features of hemophagocytic syndrome, and accumulate giant lysosomes in renal tubule cells. Homozygotes for another null allele display impaired TLR9 signaling in dendritic cells, progressive kidney pathology, and proteinuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A C 15: 102,350,564 Y19D probably damaging Het
Abca13 T A 11: 9,292,214 L1359* probably null Het
Ahi1 A T 10: 20,984,393 D671V probably damaging Het
Ahnak T C 19: 9,016,585 S5078P probably damaging Het
Ankhd1 A T 18: 36,600,834 T584S probably damaging Het
Apba2 T A 7: 64,744,447 L568* probably null Het
Cenpn C A 8: 116,940,537 L300I probably damaging Het
Cmya5 A T 13: 93,089,544 L3012Q possibly damaging Het
Cnnm1 T C 19: 43,491,472 S819P probably damaging Het
Cpa6 A T 1: 10,488,883 S87T probably benign Het
Crybg2 T A 4: 134,075,692 probably null Het
Csmd1 T A 8: 16,071,353 T1777S probably benign Het
Csmd3 G T 15: 47,947,990 P1235Q probably damaging Het
Cxcr4 T A 1: 128,589,847 N24Y probably benign Het
D630003M21Rik G T 2: 158,217,708 H91N probably damaging Het
Ece1 T C 4: 137,961,740 probably null Het
Edc3 T C 9: 57,713,428 S11P probably damaging Het
Exoc3 G A 13: 74,172,186 Q719* probably null Het
Fam13a A G 6: 58,965,198 M203T probably damaging Het
Fam160b1 C T 19: 57,384,123 R602* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fxyd2 T A 9: 45,408,330 I30N probably damaging Het
Gapt A G 13: 110,353,946 V61A probably benign Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gm2035 T C 12: 87,919,478 D127G unknown Het
Gpr35 T C 1: 92,983,220 V2A probably damaging Het
Gtf3c1 A G 7: 125,645,676 S1729P possibly damaging Het
Heatr5a T C 12: 51,959,040 T51A probably benign Het
Kat6b G A 14: 21,670,792 M1737I probably damaging Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klk10 A G 7: 43,784,985 Y267C probably damaging Het
Lyst A C 13: 13,687,813 probably null Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mfng A T 15: 78,764,382 V165D possibly damaging Het
Mto1 A G 9: 78,452,905 E225G probably damaging Het
Notch3 C A 17: 32,153,884 C571F probably damaging Het
Nup205 C T 6: 35,177,578 probably benign Het
Olfr65 T A 7: 103,906,910 I157N probably damaging Het
P2ry14 T A 3: 59,115,158 I303F probably damaging Het
Pcnx3 T C 19: 5,685,535 D421G probably damaging Het
Pdlim4 T C 11: 54,063,656 H75R possibly damaging Het
Phf21a A T 2: 92,221,611 H17L probably damaging Het
Ppid T A 3: 79,597,717 N122K probably damaging Het
Ppp4r3a T C 12: 101,043,579 I613V probably benign Het
Prcp C T 7: 92,917,766 P229S probably benign Het
Ralgds T C 2: 28,542,414 V85A probably damaging Het
Rgs22 G A 15: 36,015,636 T1034I probably benign Het
Slc4a3 T C 1: 75,549,979 V48A probably damaging Het
Snx16 A T 3: 10,438,157 M10K possibly damaging Het
Svep1 G A 4: 58,070,977 Q2270* probably null Het
Tmem185b T G 1: 119,527,463 I318S probably benign Het
Tnik C T 3: 28,620,948 R657C probably damaging Het
Top3b T C 16: 16,883,565 probably null Het
Trim40 C T 17: 36,882,427 R203H probably benign Het
Triobp T A 15: 78,967,540 N631K probably benign Het
Ubr3 T G 2: 69,979,386 Y1233* probably null Het
Vgll3 A G 16: 65,839,563 D200G probably damaging Het
Vmn2r24 G A 6: 123,779,022 E18K probably benign Het
Zfp141 C A 7: 42,489,488 R40L probably damaging Het
Other mutations in Lgmn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Lgmn APN 12 102398176 splice site probably benign
IGL02069:Lgmn APN 12 102404299 missense possibly damaging 0.92
IGL02150:Lgmn APN 12 102395727 missense possibly damaging 0.80
IGL02228:Lgmn APN 12 102395714 missense probably benign 0.04
IGL02637:Lgmn APN 12 102400226 missense probably damaging 0.98
Getz UTSW 12 102399989 missense probably damaging 0.99
R0233:Lgmn UTSW 12 102399989 missense probably damaging 0.99
R0233:Lgmn UTSW 12 102399989 missense probably damaging 0.99
R0988:Lgmn UTSW 12 102398277 missense probably damaging 0.99
R1451:Lgmn UTSW 12 102405892 splice site probably benign
R1568:Lgmn UTSW 12 102394609 missense possibly damaging 0.95
R1944:Lgmn UTSW 12 102401924 missense probably damaging 1.00
R1972:Lgmn UTSW 12 102395821 unclassified probably benign
R2133:Lgmn UTSW 12 102394908 missense probably damaging 1.00
R2298:Lgmn UTSW 12 102395678 missense probably damaging 0.99
R3846:Lgmn UTSW 12 102404329 missense possibly damaging 0.87
R4610:Lgmn UTSW 12 102400124 splice site probably benign
R4788:Lgmn UTSW 12 102402677 missense probably benign 0.11
R5050:Lgmn UTSW 12 102403421 splice site probably null
R5708:Lgmn UTSW 12 102404328 missense possibly damaging 0.87
R6090:Lgmn UTSW 12 102400154 missense probably damaging 1.00
R6420:Lgmn UTSW 12 102423719 nonsense probably null
R6496:Lgmn UTSW 12 102398239 missense probably benign 0.01
R6592:Lgmn UTSW 12 102404270 missense probably damaging 1.00
R6659:Lgmn UTSW 12 102402692 missense probably benign 0.03
R7063:Lgmn UTSW 12 102402678 missense probably damaging 1.00
R7336:Lgmn UTSW 12 102423739 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTGCCTTCCGAAGCTCTAATGG -3'
(R):5'- TTGGTGCCTGACTAAGCGAC -3'

Sequencing Primer
(F):5'- GTAGTACGAACCTATGGTCCC -3'
(R):5'- CTGACTAAGCGACAGGAAGAC -3'
Posted On2017-03-31