Incidental Mutation 'R5969:Triobp'
ID470767
Institutional Source Beutler Lab
Gene Symbol Triobp
Ensembl Gene ENSMUSG00000033088
Gene NameTRIO and F-actin binding protein
SynonymsEST478828, Mus EST 478828, Tara
MMRRC Submission 044152-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5969 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location78947724-79005869 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78967540 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 631 (N631K)
Ref Sequence ENSEMBL: ENSMUSP00000155397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228]
Predicted Effect probably benign
Transcript: ENSMUST00000109689
AA Change: N631K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: N631K

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 7.43e-13 PROSPERO
internal_repeat_1 390 540 7.43e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1395 1492 6.2e-19 SMART
coiled coil region 1665 1692 N/A INTRINSIC
coiled coil region 1727 1765 N/A INTRINSIC
coiled coil region 1789 1851 N/A INTRINSIC
coiled coil region 1885 1964 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109690
AA Change: N631K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: N631K

DomainStartEndE-ValueType
low complexity region 130 154 N/A INTRINSIC
low complexity region 291 311 N/A INTRINSIC
internal_repeat_1 312 394 9.24e-13 PROSPERO
internal_repeat_1 390 540 9.24e-13 PROSPERO
low complexity region 585 600 N/A INTRINSIC
low complexity region 638 657 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
low complexity region 767 777 N/A INTRINSIC
low complexity region 885 901 N/A INTRINSIC
low complexity region 903 923 N/A INTRINSIC
low complexity region 995 1017 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
low complexity region 1221 1235 N/A INTRINSIC
PH 1441 1538 6.2e-19 SMART
coiled coil region 1711 1738 N/A INTRINSIC
coiled coil region 1773 1811 N/A INTRINSIC
coiled coil region 1835 1897 N/A INTRINSIC
coiled coil region 1931 2010 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140228
AA Change: N631K

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaas A C 15: 102,350,564 Y19D probably damaging Het
Abca13 T A 11: 9,292,214 L1359* probably null Het
Ahi1 A T 10: 20,984,393 D671V probably damaging Het
Ahnak T C 19: 9,016,585 S5078P probably damaging Het
Ankhd1 A T 18: 36,600,834 T584S probably damaging Het
Apba2 T A 7: 64,744,447 L568* probably null Het
Cenpn C A 8: 116,940,537 L300I probably damaging Het
Cmya5 A T 13: 93,089,544 L3012Q possibly damaging Het
Cnnm1 T C 19: 43,491,472 S819P probably damaging Het
Cpa6 A T 1: 10,488,883 S87T probably benign Het
Crybg2 T A 4: 134,075,692 probably null Het
Csmd1 T A 8: 16,071,353 T1777S probably benign Het
Csmd3 G T 15: 47,947,990 P1235Q probably damaging Het
Cxcr4 T A 1: 128,589,847 N24Y probably benign Het
D630003M21Rik G T 2: 158,217,708 H91N probably damaging Het
Ece1 T C 4: 137,961,740 probably null Het
Edc3 T C 9: 57,713,428 S11P probably damaging Het
Exoc3 G A 13: 74,172,186 Q719* probably null Het
Fam13a A G 6: 58,965,198 M203T probably damaging Het
Fam160b1 C T 19: 57,384,123 R602* probably null Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Fxyd2 T A 9: 45,408,330 I30N probably damaging Het
Gapt A G 13: 110,353,946 V61A probably benign Het
Glb1l2 C T 9: 26,780,742 A74T probably damaging Het
Gm2035 T C 12: 87,919,478 D127G unknown Het
Gpr35 T C 1: 92,983,220 V2A probably damaging Het
Gtf3c1 A G 7: 125,645,676 S1729P possibly damaging Het
Heatr5a T C 12: 51,959,040 T51A probably benign Het
Kat6b G A 14: 21,670,792 M1737I probably damaging Het
Kif20a G A 18: 34,632,415 A822T probably benign Het
Klk10 A G 7: 43,784,985 Y267C probably damaging Het
Lgmn T C 12: 102,405,827 Y98C probably damaging Het
Lyst A C 13: 13,687,813 probably null Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mfng A T 15: 78,764,382 V165D possibly damaging Het
Mto1 A G 9: 78,452,905 E225G probably damaging Het
Notch3 C A 17: 32,153,884 C571F probably damaging Het
Nup205 C T 6: 35,177,578 probably benign Het
Olfr65 T A 7: 103,906,910 I157N probably damaging Het
P2ry14 T A 3: 59,115,158 I303F probably damaging Het
Pcnx3 T C 19: 5,685,535 D421G probably damaging Het
Pdlim4 T C 11: 54,063,656 H75R possibly damaging Het
Phf21a A T 2: 92,221,611 H17L probably damaging Het
Ppid T A 3: 79,597,717 N122K probably damaging Het
Ppp4r3a T C 12: 101,043,579 I613V probably benign Het
Prcp C T 7: 92,917,766 P229S probably benign Het
Ralgds T C 2: 28,542,414 V85A probably damaging Het
Rgs22 G A 15: 36,015,636 T1034I probably benign Het
Slc4a3 T C 1: 75,549,979 V48A probably damaging Het
Snx16 A T 3: 10,438,157 M10K possibly damaging Het
Svep1 G A 4: 58,070,977 Q2270* probably null Het
Tmem185b T G 1: 119,527,463 I318S probably benign Het
Tnik C T 3: 28,620,948 R657C probably damaging Het
Top3b T C 16: 16,883,565 probably null Het
Trim40 C T 17: 36,882,427 R203H probably benign Het
Ubr3 T G 2: 69,979,386 Y1233* probably null Het
Vgll3 A G 16: 65,839,563 D200G probably damaging Het
Vmn2r24 G A 6: 123,779,022 E18K probably benign Het
Zfp141 C A 7: 42,489,488 R40L probably damaging Het
Other mutations in Triobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Triobp APN 15 78993368 missense probably damaging 1.00
IGL01904:Triobp APN 15 78967364 missense possibly damaging 0.80
IGL01957:Triobp APN 15 78972647 critical splice donor site probably null
IGL02085:Triobp APN 15 78974297 splice site probably benign
IGL02260:Triobp APN 15 78966362 missense probably benign 0.00
IGL02498:Triobp APN 15 78961043 missense probably benign 0.01
IGL02551:Triobp APN 15 78973489 missense probably benign
IGL02740:Triobp APN 15 78966689 missense probably benign 0.21
IGL02810:Triobp APN 15 79002203 missense possibly damaging 0.95
IGL03063:Triobp APN 15 78990884 missense probably damaging 1.00
FR4304:Triobp UTSW 15 78993387 unclassified probably benign
FR4340:Triobp UTSW 15 78993390 unclassified probably benign
FR4342:Triobp UTSW 15 78993392 unclassified probably benign
FR4449:Triobp UTSW 15 78993389 unclassified probably benign
FR4548:Triobp UTSW 15 78993387 unclassified probably benign
FR4548:Triobp UTSW 15 78993390 unclassified probably benign
R0276:Triobp UTSW 15 78973676 missense probably benign 0.09
R0309:Triobp UTSW 15 78976540 missense probably damaging 1.00
R0433:Triobp UTSW 15 78968201 missense possibly damaging 0.69
R0464:Triobp UTSW 15 78966986 missense possibly damaging 0.71
R0525:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0665:Triobp UTSW 15 78973898 missense possibly damaging 0.93
R0689:Triobp UTSW 15 78959988 nonsense probably null
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1149:Triobp UTSW 15 78966479 missense probably benign 0.00
R1151:Triobp UTSW 15 78966479 missense probably benign 0.00
R1152:Triobp UTSW 15 78966479 missense probably benign 0.00
R1510:Triobp UTSW 15 79003767 missense probably damaging 1.00
R1519:Triobp UTSW 15 78973738 missense probably benign 0.00
R1642:Triobp UTSW 15 79002148 missense probably damaging 1.00
R1732:Triobp UTSW 15 78967228 missense possibly damaging 0.69
R1755:Triobp UTSW 15 78966479 missense probably benign 0.00
R1975:Triobp UTSW 15 78966708 missense probably benign
R2051:Triobp UTSW 15 79004540 missense probably damaging 1.00
R2073:Triobp UTSW 15 78973895 missense probably damaging 0.99
R2260:Triobp UTSW 15 78991440 critical splice donor site probably null
R2351:Triobp UTSW 15 79004580 missense probably benign 0.09
R2902:Triobp UTSW 15 78973418 missense possibly damaging 0.90
R3801:Triobp UTSW 15 78973700 missense probably benign 0.04
R3959:Triobp UTSW 15 79002389 nonsense probably null
R4003:Triobp UTSW 15 78959977 unclassified probably benign
R4084:Triobp UTSW 15 78973671 missense probably benign 0.19
R4482:Triobp UTSW 15 78966563 missense possibly damaging 0.87
R4592:Triobp UTSW 15 78967095 missense probably benign
R4662:Triobp UTSW 15 78993269 missense probably damaging 1.00
R4732:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4733:Triobp UTSW 15 78967113 missense probably damaging 0.99
R4789:Triobp UTSW 15 78991028 missense probably damaging 1.00
R4968:Triobp UTSW 15 78966616 missense probably benign 0.03
R4990:Triobp UTSW 15 78967005 missense probably benign 0.00
R5129:Triobp UTSW 15 78961096 missense probably benign 0.15
R5181:Triobp UTSW 15 78967754 missense probably benign 0.00
R5279:Triobp UTSW 15 78994391 missense possibly damaging 0.66
R5584:Triobp UTSW 15 78968132 missense possibly damaging 0.89
R5601:Triobp UTSW 15 78973633 missense probably damaging 1.00
R5810:Triobp UTSW 15 78968267 missense probably benign 0.07
R6722:Triobp UTSW 15 79001565 missense probably damaging 1.00
R6739:Triobp UTSW 15 78966366 missense possibly damaging 0.77
R6810:Triobp UTSW 15 78966615 missense possibly damaging 0.47
R7011:Triobp UTSW 15 78978723 missense probably damaging 0.98
R7015:Triobp UTSW 15 78994060 missense probably damaging 0.99
R7200:Triobp UTSW 15 78966842 small deletion probably benign
R7294:Triobp UTSW 15 78973976 missense probably damaging 0.99
R7688:Triobp UTSW 15 78961111 splice site probably null
R7805:Triobp UTSW 15 78974004 missense probably benign 0.37
R7972:Triobp UTSW 15 78967986 missense probably damaging 1.00
R7977:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7987:Triobp UTSW 15 79001544 missense probably damaging 1.00
R7999:Triobp UTSW 15 78959944 missense probably damaging 0.99
R8344:Triobp UTSW 15 78958275 missense possibly damaging 0.67
R8348:Triobp UTSW 15 78994126 missense possibly damaging 0.85
RF001:Triobp UTSW 15 78967027 small insertion probably benign
RF005:Triobp UTSW 15 78967061 small insertion probably benign
RF007:Triobp UTSW 15 78967044 small insertion probably benign
RF022:Triobp UTSW 15 78974282 missense probably benign 0.05
RF028:Triobp UTSW 15 78967039 small insertion probably benign
RF032:Triobp UTSW 15 78967036 small insertion probably benign
RF035:Triobp UTSW 15 78967039 small insertion probably benign
RF039:Triobp UTSW 15 78967036 small insertion probably benign
RF039:Triobp UTSW 15 78967039 small insertion probably benign
RF040:Triobp UTSW 15 78967063 small insertion probably benign
RF049:Triobp UTSW 15 78967061 small insertion probably benign
RF051:Triobp UTSW 15 78967034 small insertion probably benign
RF058:Triobp UTSW 15 78967044 small insertion probably benign
X0026:Triobp UTSW 15 78960023 missense possibly damaging 0.94
Z1177:Triobp UTSW 15 79002181 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGATATCCCTTGGGCTTCC -3'
(R):5'- CGATTCACTCTCAGACGAGC -3'

Sequencing Primer
(F):5'- AAAGATATCCCTTGGGCTTCCTTTCC -3'
(R):5'- TCTCAGACGAGCGGGGATC -3'
Posted On2017-03-31