Mutagenetix > Incidental Mutation

Incidental Mutation 'R0501:Kif21b'

47077

Institutional Source

Beutler Lab

Gene Symbol

Kif21b

Ensembl Gene

ENSMUSG00000041642

Gene Name

kinesin family member 21B

Synonyms

N-5 kinesin, 2610511N21Rik

MMRRC Submission

038696-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.111) question?

Stock #

R0501 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

136131389-136177998 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 136163099 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1215 (D1215V)

Ref Sequence

ENSEMBL: ENSMUSP00000114297 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864] [ENSMUST00000171381]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000075164
AA Change: D1215V

PolyPhen 2 Score 0.266 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: D1215V

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	3.81e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127624

Predicted Effect

probably benign
Transcript: ENSMUST00000130864
AA Change: D1215V

PolyPhen 2 Score 0.436 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: D1215V

Domain	Start	End	E-Value	Type
KISc	6	379	6.39e-159	SMART
Blast:KISc	469	543	1e-14	BLAST
low complexity region	578	628	N/A	INTRINSIC
coiled coil region	632	825	N/A	INTRINSIC
low complexity region	847	866	N/A	INTRINSIC
coiled coil region	931	991	N/A	INTRINSIC
low complexity region	1109	1123	N/A	INTRINSIC
low complexity region	1239	1249	N/A	INTRINSIC
low complexity region	1266	1279	N/A	INTRINSIC
WD40	1299	1336	2.89e-5	SMART
WD40	1339	1377	5.69e-4	SMART
WD40	1404	1441	6.42e-1	SMART
WD40	1444	1486	1.5e-3	SMART
WD40	1494	1532	4.8e-2	SMART
WD40	1535	1575	1.55e-5	SMART
WD40	1578	1615	5.1e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171381

Coding Region Coverage

1x: 99.7%
3x: 98.9%
10x: 97.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700030K09Rik	T	C	8: 72,455,372	S415P	probably benign	Het
Adam19	C	T	11: 46,123,130	P316S	probably damaging	Het
Adamts2	A	G	11: 50,668,145	D229G	probably benign	Het
Adcy10	C	T	1: 165,510,390	P191L	probably damaging	Het
Adgrv1	T	C	13: 81,559,150	Y1379C	probably damaging	Het
Akap9	T	C	5: 3,970,685	L1132P	probably damaging	Het
Aoah	A	G	13: 21,005,073	T489A	probably benign	Het
Apc2	T	C	10: 80,315,124	L1975P	probably damaging	Het
Bpifa5	A	T	2: 154,163,696	D66V	probably benign	Het
C230029F24Rik	T	C	1: 49,335,470		noncoding transcript	Het
Cacna1h	A	T	17: 25,388,667	V892E	probably damaging	Het
Car4	G	A	11: 84,963,442	V72I	probably benign	Het
Chst3	A	G	10: 60,186,227	L266P	probably damaging	Het
Ckap2l	G	A	2: 129,285,491	R256W	possibly damaging	Het
Cntn4	A	T	6: 106,618,335	D471V	probably damaging	Het
Cntrob	G	A	11: 69,322,868	S32F	probably damaging	Het
Cpne7	T	A	8: 123,126,255	N200K	possibly damaging	Het
Creb3l3	C	A	10: 81,086,582	M271I	probably benign	Het
Csmd1	T	A	8: 17,027,323	Q106L	probably damaging	Het
D7Ertd443e	G	A	7: 134,294,972	T563I	probably damaging	Het
Dmac1	T	G	4: 75,278,176	N26H	unknown	Het
Dopey2	T	C	16: 93,752,862	F230L	probably benign	Het
Dpp6	T	A	5: 27,725,606	I812N	probably damaging	Het
Fabp12	T	C	3: 10,250,143	D48G	probably benign	Het
Fbn1	G	A	2: 125,301,749	T2820M	probably benign	Het
Fcho1	C	T	8: 71,712,560	A418T	probably benign	Het
Fcho2	A	T	13: 98,764,515	S277R	possibly damaging	Het
Fmo2	A	G	1: 162,876,928	S470P	probably benign	Het
Gm17541	T	G	12: 4,689,730		probably benign	Het
Gm4353	A	T	7: 116,083,471	Y292N	probably benign	Het
Igkv4-71	A	T	6: 69,243,306	I69N	probably damaging	Het
Insrr	G	T	3: 87,810,684	A871S	probably benign	Het
Irs2	C	T	8: 11,006,396	V679M	probably damaging	Het
Itpr3	T	A	17: 27,107,289	H1344Q	probably benign	Het
Kcnma1	T	C	14: 23,311,716	M1074V	possibly damaging	Het
Kif1a	G	A	1: 93,056,245	R602W	probably damaging	Het
Maats1	C	G	16: 38,335,635	M75I	probably damaging	Het
Mapk13	G	A	17: 28,776,353	V183M	probably damaging	Het
Mbp	C	T	18: 82,575,197	S100F	probably damaging	Het
Mcm6	A	G	1: 128,355,636	I44T	probably benign	Het
Ncor1	T	A	11: 62,373,322	D418V	possibly damaging	Het
Nid2	T	A	14: 19,789,668		probably null	Het
Nolc1	T	C	19: 46,078,920	V80A	probably damaging	Het
Olfr1024	A	G	2: 85,905,004	F17L	probably damaging	Het
Olfr1121	A	T	2: 87,371,552	R7W	probably damaging	Het
Olfr1162	A	T	2: 88,050,471	I51N	probably damaging	Het
Olfr1240	T	C	2: 89,439,716	T188A	probably benign	Het
Olfr1338	C	A	4: 118,753,830	C238F	probably benign	Het
Olfr1508	T	A	14: 52,463,926	M1L	possibly damaging	Het
Olfr3	A	T	2: 36,812,480	L204*	probably null	Het
Olfr70	A	C	4: 43,697,079	C31W	probably damaging	Het
Olfr700	G	A	7: 106,805,811	S217F	probably damaging	Het
Olfr705	A	T	7: 106,714,603	M26K	probably benign	Het
Olfr713	A	T	7: 107,036,232	T26S	probably benign	Het
Olfr855	T	A	9: 19,584,618	I27N	probably damaging	Het
Pcgf3	T	A	5: 108,475,112	C38S	probably damaging	Het
Pdia4	A	T	6: 47,801,002	V352E	probably damaging	Het
Pik3c2a	C	A	7: 116,354,055	V1202L	probably damaging	Het
Rbm15	G	T	3: 107,332,530	A184E	possibly damaging	Het
Rsph3a	T	A	17: 7,979,120	L442*	probably null	Het
Scg2	G	C	1: 79,435,603	L468V	probably damaging	Het
Sdk1	A	T	5: 141,937,718	I365L	probably benign	Het
Setdb1	A	G	3: 95,338,829	V595A	probably benign	Het
Slc22a22	T	A	15: 57,249,650	T398S	probably benign	Het
Stk11	C	A	10: 80,126,285	P217Q	probably damaging	Het
Tes	G	A	6: 17,097,558	D222N	probably benign	Het
Tmem132e	T	A	11: 82,435,068	I206N	possibly damaging	Het
Tmem214	G	T	5: 30,872,532	R251L	probably damaging	Het
Tmem253	T	A	14: 52,018,579	I105N	probably damaging	Het
Toe1	A	G	4: 116,807,485	V12A	probably benign	Het
Top1	C	A	2: 160,714,159	H513N	probably damaging	Het
Tph1	G	T	7: 46,649,988	Y376*	probably null	Het
Trim45	T	A	3: 100,923,219	L103Q	probably damaging	Het
Ttc37	A	C	13: 76,147,806	M1063L	probably benign	Het
Ttn	T	A	2: 76,944,174		probably null	Het
Twnk	T	C	19: 45,007,746	V206A	probably damaging	Het
Ube2z	A	G	11: 96,050,288	S343P	probably damaging	Het
Vmn2r8	T	C	5: 108,803,183	D132G	probably benign	Het
Wdr20rt	A	T	12: 65,225,807	T15S	probably benign	Het
Wdr59	C	T	8: 111,458,947	R841Q	possibly damaging	Het
Wdtc1	A	G	4: 133,308,840	F130L	possibly damaging	Het
Wnk1	C	T	6: 119,962,803	R43Q	probably damaging	Het
Ythdf3	T	C	3: 16,205,072	L461P	probably damaging	Het
Zcchc2	T	G	1: 106,016,091	F462C	possibly damaging	Het

Other mutations in Kif21b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Kif21b	APN	1	136152342	missense	possibly damaging	0.68
IGL01020:Kif21b	APN	1	136154094	splice site	probably benign
IGL01288:Kif21b	APN	1	136172184	missense	probably benign	0.00
IGL02105:Kif21b	APN	1	136171303	missense	probably benign
IGL02264:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02303:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02308:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02310:Kif21b	APN	1	136159757	missense	probably damaging	1.00
IGL02419:Kif21b	APN	1	136151267	missense	probably benign	0.00
IGL02553:Kif21b	APN	1	136154121	missense	probably damaging	1.00
IGL02568:Kif21b	APN	1	136172867	missense	probably damaging	0.96
IGL02657:Kif21b	APN	1	136172230	missense	possibly damaging	0.88
IGL03068:Kif21b	APN	1	136158355	unclassified	probably benign
IGL03230:Kif21b	APN	1	136162812	missense	probably benign	0.03
R0629_Kif21b_729	UTSW	1	136172157	critical splice acceptor site	probably null
Schiessen	UTSW	1	136147869	critical splice donor site	probably null
wolfen	UTSW	1	136144758	nonsense	probably null
R0190:Kif21b	UTSW	1	136171219	missense	probably benign	0.32
R0349:Kif21b	UTSW	1	136149311	missense	probably damaging	0.97
R0620:Kif21b	UTSW	1	136159428	missense	possibly damaging	0.88
R0629:Kif21b	UTSW	1	136172157	critical splice acceptor site	probably null
R0741:Kif21b	UTSW	1	136159744	missense	probably damaging	1.00
R1087:Kif21b	UTSW	1	136162823	missense	probably damaging	1.00
R1217:Kif21b	UTSW	1	136152376	missense	probably damaging	1.00
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1464:Kif21b	UTSW	1	136156153	missense	possibly damaging	0.50
R1511:Kif21b	UTSW	1	136169324	critical splice donor site	probably null
R1512:Kif21b	UTSW	1	136152805	missense	probably benign	0.01
R1513:Kif21b	UTSW	1	136156111	missense	probably damaging	0.98
R1591:Kif21b	UTSW	1	136149317	missense	probably damaging	1.00
R1616:Kif21b	UTSW	1	136171685	missense	probably damaging	1.00
R1628:Kif21b	UTSW	1	136171220	missense	probably benign	0.01
R1658:Kif21b	UTSW	1	136171285	missense	probably damaging	1.00
R1728:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1741:Kif21b	UTSW	1	136156142	missense	probably damaging	1.00
R1784:Kif21b	UTSW	1	136160121	missense	possibly damaging	0.85
R1807:Kif21b	UTSW	1	136147793	missense	possibly damaging	0.94
R1896:Kif21b	UTSW	1	136147845	missense	possibly damaging	0.90
R1970:Kif21b	UTSW	1	136171156	missense	probably damaging	1.00
R1984:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1985:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1986:Kif21b	UTSW	1	136147546	missense	probably damaging	1.00
R1988:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R1990:Kif21b	UTSW	1	136161770	missense	probably damaging	1.00
R2014:Kif21b	UTSW	1	136148282	missense	probably damaging	1.00
R2045:Kif21b	UTSW	1	136160313	missense	probably damaging	1.00
R2141:Kif21b	UTSW	1	136152264	missense	probably damaging	0.98
R2248:Kif21b	UTSW	1	136172966	missense	probably damaging	1.00
R2886:Kif21b	UTSW	1	136147874	splice site	probably benign
R2896:Kif21b	UTSW	1	136154217	missense	possibly damaging	0.82
R3706:Kif21b	UTSW	1	136159410	missense	probably benign	0.06
R3780:Kif21b	UTSW	1	136156226	missense	probably damaging	0.99
R3827:Kif21b	UTSW	1	136162994	critical splice donor site	probably null
R4227:Kif21b	UTSW	1	136154093	splice site	probably null
R4600:Kif21b	UTSW	1	136147864	missense	probably benign	0.39
R4608:Kif21b	UTSW	1	136148186	intron	probably benign
R4749:Kif21b	UTSW	1	136144749	nonsense	probably null
R4841:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4842:Kif21b	UTSW	1	136145220	missense	probably damaging	1.00
R4933:Kif21b	UTSW	1	136151325	splice site	probably null
R4959:Kif21b	UTSW	1	136148370	missense	possibly damaging	0.90
R5018:Kif21b	UTSW	1	136172234	missense	probably benign	0.30
R5116:Kif21b	UTSW	1	136152783	missense	probably damaging	0.99
R5119:Kif21b	UTSW	1	136163100	missense	probably benign
R5197:Kif21b	UTSW	1	136144625	missense	probably damaging	1.00
R5230:Kif21b	UTSW	1	136171673	missense	probably damaging	1.00
R5249:Kif21b	UTSW	1	136169228	missense	probably damaging	1.00
R5337:Kif21b	UTSW	1	136171143	missense	probably damaging	1.00
R5358:Kif21b	UTSW	1	136172292	missense	possibly damaging	0.85
R5466:Kif21b	UTSW	1	136147525	missense	probably damaging	1.00
R5557:Kif21b	UTSW	1	136170059	missense	probably damaging	1.00
R5727:Kif21b	UTSW	1	136170009	missense	probably damaging	1.00
R5865:Kif21b	UTSW	1	136151137	nonsense	probably null
R5929:Kif21b	UTSW	1	136151207	missense	probably damaging	1.00
R6274:Kif21b	UTSW	1	136149418	missense	possibly damaging	0.57
R6349:Kif21b	UTSW	1	136158326	missense	probably damaging	1.00
R6648:Kif21b	UTSW	1	136152397	missense	probably benign	0.00
R6831:Kif21b	UTSW	1	136144758	nonsense	probably null
R7156:Kif21b	UTSW	1	136147824	missense	probably damaging	1.00
R7165:Kif21b	UTSW	1	136149448	missense	probably damaging	0.98
R7327:Kif21b	UTSW	1	136159649	missense	possibly damaging	0.60
R7680:Kif21b	UTSW	1	136147869	critical splice donor site	probably null
R7975:Kif21b	UTSW	1	136171173	missense	probably damaging	1.00
R8356:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
R8467:Kif21b	UTSW	1	136172283	missense	probably damaging	0.98
R9031:Kif21b	UTSW	1	136145304	missense	probably damaging	0.99
R9101:Kif21b	UTSW	1	136151155	missense	probably damaging	0.96
R9191:Kif21b	UTSW	1	136172821	nonsense	probably null
R9261:Kif21b	UTSW	1	136149424	missense	probably damaging	1.00
R9280:Kif21b	UTSW	1	136171707	critical splice donor site	probably null
R9307:Kif21b	UTSW	1	136174062	missense	probably benign
R9562:Kif21b	UTSW	1	136149352	missense	probably damaging	0.99
R9563:Kif21b	UTSW	1	136149428	missense	probably damaging	1.00
R9565:Kif21b	UTSW	1	136149352	missense	probably damaging	0.99
R9758:Kif21b	UTSW	1	136153223	missense	probably damaging	1.00
R9760:Kif21b	UTSW	1	136148683	missense	probably damaging	1.00
RF024:Kif21b	UTSW	1	136158341	missense	probably damaging	1.00
X0053:Kif21b	UTSW	1	136149316	missense	probably damaging	1.00
X0066:Kif21b	UTSW	1	136172945	missense	probably damaging	1.00
Z1176:Kif21b	UTSW	1	136154137	missense	probably benign	0.00
Z1177:Kif21b	UTSW	1	136148312	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAAGCTATCCGCACAGATGAAGG -3'
(R):5'- GCAAGTGTGATGATGGTCCACAGAG -3'

Sequencing Primer
(F):5'- TCCCTCGTTGAGATCAAAGAG -3'
(R):5'- TGGTCCACAGAGAAGAAGCTC -3'

Posted On

2013-06-12