Incidental Mutation 'R5970:Rp1'
ID470782
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Nameretinitis pigmentosa 1 (human)
SynonymsDcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h
MMRRC Submission 044153-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5970 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location3999557-4409241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4348462 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 809 (L809P)
Ref Sequence ENSEMBL: ENSMUSP00000027032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027032] [ENSMUST00000194992] [ENSMUST00000208660]
Predicted Effect probably benign
Transcript: ENSMUST00000027032
AA Change: L809P

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027032
Gene: ENSMUSG00000025900
AA Change: L809P

DomainStartEndE-ValueType
DCX 30 117 4.37e-39 SMART
low complexity region 120 133 N/A INTRINSIC
DCX 152 236 7.17e-35 SMART
low complexity region 343 354 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 646 661 N/A INTRINSIC
low complexity region 1113 1123 N/A INTRINSIC
low complexity region 1396 1412 N/A INTRINSIC
low complexity region 1434 1444 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194992
SMART Domains Protein: ENSMUSP00000142146
Gene: ENSMUSG00000025900

DomainStartEndE-ValueType
DCX 40 127 4.37e-39 SMART
low complexity region 130 143 N/A INTRINSIC
DCX 162 246 7.17e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000208660
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208793
Meta Mutation Damage Score 0.1411 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,597,046 probably benign Het
Ambn T C 5: 88,467,951 V413A possibly damaging Het
Amotl1 T A 9: 14,596,528 D41V probably damaging Het
Arhgef26 T C 3: 62,340,047 V184A probably benign Het
Birc6 G T 17: 74,618,502 G936V possibly damaging Het
Ccser1 T A 6: 61,311,242 S130T possibly damaging Het
Cecr2 A G 6: 120,720,907 I56V probably damaging Het
Cfap52 A G 11: 67,930,744 I486T probably damaging Het
Col4a3 A G 1: 82,716,329 I1557V possibly damaging Het
Col6a5 T A 9: 105,945,847 I104F unknown Het
Cry2 A G 2: 92,412,967 S510P probably benign Het
Csmd2 G C 4: 128,546,151 A3133P probably benign Het
Cyld G T 8: 88,732,993 A611S probably damaging Het
Dennd4c G A 4: 86,825,512 G1197E probably damaging Het
Dnah10 T C 5: 124,808,729 F2969L probably benign Het
Dnaic1 A G 4: 41,625,281 K415R probably benign Het
Dnmbp T A 19: 43,854,171 T1253S probably benign Het
Dsp T C 13: 38,195,702 L1542P possibly damaging Het
Duox1 T A 2: 122,340,201 L1234Q probably damaging Het
Efr3b T A 12: 3,968,590 R585S possibly damaging Het
Gpt A G 15: 76,699,352 probably null Het
Heatr6 G A 11: 83,753,718 probably benign Het
Kcns2 A G 15: 34,839,784 D431G probably benign Het
Kdm3b A G 18: 34,829,289 N1543D probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mical3 G A 6: 120,958,271 Q893* probably null Het
Morc3 C T 16: 93,866,453 H515Y possibly damaging Het
Mprip A T 11: 59,757,721 R750S probably damaging Het
Mroh1 G A 15: 76,451,491 V1436M probably benign Het
Muc5ac C T 7: 141,790,669 R69* probably null Het
Muc5b A T 7: 141,856,712 Y1274F unknown Het
Mybpc1 A G 10: 88,542,456 L674P probably damaging Het
Mypn A G 10: 63,131,023 V958A probably benign Het
Nipbl T C 15: 8,296,818 T2436A probably benign Het
Olfr835 A G 9: 19,035,147 D8G probably benign Het
Pcdhb5 T A 18: 37,321,773 L402Q probably damaging Het
Pigp T A 16: 94,370,194 probably null Het
Scn3a T A 2: 65,494,781 probably benign Het
Sdf2 A T 11: 78,246,080 M29L probably benign Het
Serpina3b T G 12: 104,134,091 L311V possibly damaging Het
Snx31 A T 15: 36,523,488 Y349* probably null Het
Spidr A C 16: 16,114,869 C182W probably damaging Het
St13 A T 15: 81,377,798 S146R probably damaging Het
St8sia4 A G 1: 95,653,582 V145A probably damaging Het
Stradb T C 1: 58,980,016 probably null Het
Tcp11l2 T A 10: 84,594,797 probably benign Het
Tfdp2 C T 9: 96,317,574 P74S unknown Het
Tmprss15 C T 16: 79,057,659 R287H probably benign Het
Trav10d T C 14: 52,811,322 Y57H probably damaging Het
Vmn2r104 A G 17: 20,029,471 I846T probably benign Het
Ywhah T A 5: 33,026,948 M165K possibly damaging Het
Zfp324 C A 7: 12,969,366 P72T probably benign Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4346746 missense probably damaging 0.98
IGL00593:Rp1 APN 1 4345403 missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4352212 missense probably damaging 1.00
IGL01070:Rp1 APN 1 4345238 missense probably damaging 1.00
IGL01531:Rp1 APN 1 4348945 missense probably benign 0.00
IGL01668:Rp1 APN 1 4345718 missense probably damaging 1.00
IGL01907:Rp1 APN 1 4348507 missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4352522 missense probably damaging 1.00
IGL02071:Rp1 APN 1 4345310 missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4347385 missense probably damaging 0.99
IGL02244:Rp1 APN 1 4348780 missense probably benign 0.00
IGL02381:Rp1 APN 1 4352390 missense probably benign 0.01
IGL02499:Rp1 APN 1 4349048 missense probably benign 0.17
IGL02619:Rp1 APN 1 4348450 missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4349713 missense probably benign 0.03
IGL02861:Rp1 APN 1 4346152 nonsense probably null
IGL03288:Rp1 APN 1 4349524 missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4350041 missense probably damaging 1.00
IGL03303:Rp1 APN 1 4344817 missense probably damaging 1.00
R0041:Rp1 UTSW 1 4344628 missense probably benign 0.36
R0111:Rp1 UTSW 1 4344760 missense probably damaging 1.00
R0363:Rp1 UTSW 1 4347718 missense probably damaging 1.00
R0440:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R0442:Rp1 UTSW 1 4346747 missense probably benign 0.09
R0528:Rp1 UTSW 1 4344865 missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4346498 missense probably benign 0.00
R0856:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0908:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0968:Rp1 UTSW 1 4345352 missense probably benign 0.00
R1099:Rp1 UTSW 1 4352290 missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4344962 missense probably benign 0.03
R1301:Rp1 UTSW 1 4345936 missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4347970 missense probably benign 0.01
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4347396 missense probably damaging 1.00
R1509:Rp1 UTSW 1 4347694 missense probably damaging 0.98
R1509:Rp1 UTSW 1 4348537 missense probably benign 0.20
R1538:Rp1 UTSW 1 4345676 missense probably damaging 1.00
R1609:Rp1 UTSW 1 4349201 missense probably damaging 1.00
R1666:Rp1 UTSW 1 4349863 missense probably damaging 1.00
R1703:Rp1 UTSW 1 4345169 missense probably damaging 1.00
R1782:Rp1 UTSW 1 4349089 missense probably benign 0.00
R1799:Rp1 UTSW 1 4348832 missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4347232 missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4348720 missense probably damaging 0.99
R1919:Rp1 UTSW 1 4352671 missense probably damaging 0.99
R2087:Rp1 UTSW 1 4348352 missense probably damaging 1.00
R2211:Rp1 UTSW 1 4348139 missense probably damaging 0.96
R2278:Rp1 UTSW 1 4348027 missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4345959 nonsense probably null
R2316:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R2346:Rp1 UTSW 1 4348013 missense probably damaging 1.00
R2878:Rp1 UTSW 1 4348139 missense probably damaging 1.00
R3023:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3025:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3716:Rp1 UTSW 1 4349765 missense probably benign 0.38
R3814:Rp1 UTSW 1 4349708 missense probably benign
R3929:Rp1 UTSW 1 4352645 missense probably damaging 1.00
R4064:Rp1 UTSW 1 4345400 missense probably benign 0.08
R4426:Rp1 UTSW 1 4347924 missense probably benign 0.13
R4557:Rp1 UTSW 1 4344663 missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4345878 missense probably damaging 0.96
R4845:Rp1 UTSW 1 4349228 missense probably benign 0.02
R4850:Rp1 UTSW 1 4348675 missense probably damaging 1.00
R4857:Rp1 UTSW 1 4352316 missense probably damaging 0.99
R4857:Rp1 UTSW 1 4352317 missense probably damaging 1.00
R5159:Rp1 UTSW 1 4346203 missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4348033 missense probably benign 0.01
R5327:Rp1 UTSW 1 4349360 splice site probably null
R5352:Rp1 UTSW 1 4347098 missense probably benign 0.00
R5504:Rp1 UTSW 1 4349890 missense probably damaging 1.00
R5527:Rp1 UTSW 1 4346393 missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4345832 missense probably benign 0.42
R5569:Rp1 UTSW 1 4345237 missense probably damaging 1.00
R5622:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R5992:Rp1 UTSW 1 4148703 missense unknown
R6004:Rp1 UTSW 1 4197585 missense unknown
R6018:Rp1 UTSW 1 4352836 missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4345379 missense probably benign 0.02
R6127:Rp1 UTSW 1 4349311 missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4349869 missense probably damaging 1.00
R6301:Rp1 UTSW 1 4347254 missense probably benign 0.04
R6317:Rp1 UTSW 1 4041989 missense unknown
R6405:Rp1 UTSW 1 4345771 missense probably damaging 1.00
R6445:Rp1 UTSW 1 4226617 missense unknown
R6466:Rp1 UTSW 1 4347886 missense probably benign 0.01
R6501:Rp1 UTSW 1 4311280 intron probably benign
R6547:Rp1 UTSW 1 4170305 missense unknown
R6604:Rp1 UTSW 1 4019128 missense unknown
R6700:Rp1 UTSW 1 4349896 missense probably damaging 1.00
R6706:Rp1 UTSW 1 4142664 missense unknown
R6831:Rp1 UTSW 1 4349864 splice site probably null
R6918:Rp1 UTSW 1 3999608 missense unknown
R6973:Rp1 UTSW 1 4351994 nonsense probably null
R6981:Rp1 UTSW 1 4345655 missense probably benign 0.06
R7009:Rp1 UTSW 1 4042068 missense unknown
R7078:Rp1 UTSW 1 4206791 missense unknown
R7112:Rp1 UTSW 1 4349018 missense probably benign 0.43
R7135:Rp1 UTSW 1 4348168 missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4349917 missense probably damaging 0.99
R7199:Rp1 UTSW 1 4347290 missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4228601 missense unknown
R7367:Rp1 UTSW 1 4347998 missense probably benign 0.42
R7484:Rp1 UTSW 1 4345481 missense probably benign 0.10
R7500:Rp1 UTSW 1 4311278 missense unknown
R7569:Rp1 UTSW 1 4284840 missense unknown
R7642:Rp1 UTSW 1 4147831 missense unknown
R7693:Rp1 UTSW 1 4347403 missense probably damaging 1.00
R7742:Rp1 UTSW 1 4170234 missense unknown
R7759:Rp1 UTSW 1 4344884 missense probably benign
R7784:Rp1 UTSW 1 4142658 missense unknown
R7816:Rp1 UTSW 1 4347703 missense probably damaging 0.98
R7866:Rp1 UTSW 1 4347701 missense probably benign 0.02
R8215:Rp1 UTSW 1 4245095 missense unknown
R8281:Rp1 UTSW 1 4347916 missense probably damaging 1.00
R8294:Rp1 UTSW 1 4345997 missense probably benign 0.09
R8309:Rp1 UTSW 1 4347089 missense probably benign 0.00
R8311:Rp1 UTSW 1 4348349 missense probably benign 0.11
R8500:Rp1 UTSW 1 4346590 missense possibly damaging 0.91
R8559:Rp1 UTSW 1 4349561 missense probably damaging 1.00
R8672:Rp1 UTSW 1 4348784 missense possibly damaging 0.55
R8688:Rp1 UTSW 1 4346405 missense probably benign 0.01
R8792:Rp1 UTSW 1 4024868 missense unknown
RF003:Rp1 UTSW 1 4344694 missense probably damaging 0.99
V1662:Rp1 UTSW 1 4349560 missense probably damaging 1.00
X0012:Rp1 UTSW 1 4347695 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTAACATGCTGTTCACTTACCTCAG -3'
(R):5'- AAGAGTTTGTGAGCAGGGCC -3'

Sequencing Primer
(F):5'- ACCTCAGCACCTGACTTTAATTTAAC -3'
(R):5'- GCAGGGCCTTAATATAAGTCCTATGG -3'
Posted On2017-03-31