Mutagenetix > Incidental Mutation

Incidental Mutation 'R5970:Stradb'

470783

Institutional Source

Beutler Lab

Gene Symbol

Stradb

Ensembl Gene

ENSMUSG00000026027

Gene Name

STE20-related kinase adaptor beta

Synonyms

Als2cr2, D1Ucla2, PRO1038

MMRRC Submission

044153-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5970 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58973522-58995715 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 58980016 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000109935 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027185] [ENSMUST00000114296] [ENSMUST00000114296] [ENSMUST00000123301] [ENSMUST00000153990]

AlphaFold

Q8K4T3

Predicted Effect

probably null
Transcript: ENSMUST00000027185

SMART Domains

Protein: ENSMUSP00000027185
Gene: ENSMUSG00000026027

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	58	290	3.2e-26	PFAM
Pfam:Pkinase	58	369	7.9e-37	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000114296

SMART Domains

Protein: ENSMUSP00000109935
Gene: ENSMUSG00000026027

Domain	Start	End	E-Value	Type
Pfam:Pkinase	58	185	1.1e-16	PFAM
Pfam:Pkinase_Tyr	58	188	1.3e-13	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000114296

SMART Domains

Protein: ENSMUSP00000109935
Gene: ENSMUSG00000026027

Domain	Start	End	E-Value	Type
Pfam:Pkinase	58	185	1.1e-16	PFAM
Pfam:Pkinase_Tyr	58	188	1.3e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123301

SMART Domains

Protein: ENSMUSP00000138036
Gene: ENSMUSG00000026027

Domain	Start	End	E-Value	Type
Pfam:Pkinase	58	184	2.7e-17	PFAM
Pfam:Pkinase_Tyr	58	185	1.1e-13	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123965

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147637

Predicted Effect

probably benign
Transcript: ENSMUST00000153990

Meta Mutation Damage Score

0.9490

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase STE20 subfamily. One of the active site residues in the protein kinase domain of this protein is altered, and it is thus a pseudokinase. This protein is a component of a complex involved in the activation of serine/threonine kinase 11, a master kinase that regulates cell polarity and energy-generating metabolism. This complex regulates the relocation of this kinase from the nucleus to the cytoplasm, and it is essential for G1 cell cycle arrest mediated by this kinase. The protein encoded by this gene can also interact with the X chromosome-linked inhibitor of apoptosis protein, and this interaction enhances the anti-apoptotic activity of this protein via the JNK1 signal transduction pathway. Two pseudogenes, located on chromosomes 1 and 7, have been found for this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1l1	G	A	6: 90,597,046		probably benign	Het
Ambn	T	C	5: 88,467,951	V413A	possibly damaging	Het
Amotl1	T	A	9: 14,596,528	D41V	probably damaging	Het
Arhgef26	T	C	3: 62,340,047	V184A	probably benign	Het
Birc6	G	T	17: 74,618,502	G936V	possibly damaging	Het
Ccser1	T	A	6: 61,311,242	S130T	possibly damaging	Het
Cecr2	A	G	6: 120,720,907	I56V	probably damaging	Het
Cfap52	A	G	11: 67,930,744	I486T	probably damaging	Het
Col4a3	A	G	1: 82,716,329	I1557V	possibly damaging	Het
Col6a5	T	A	9: 105,945,847	I104F	unknown	Het
Cry2	A	G	2: 92,412,967	S510P	probably benign	Het
Csmd2	G	C	4: 128,546,151	A3133P	probably benign	Het
Cyld	G	T	8: 88,732,993	A611S	probably damaging	Het
Dennd4c	G	A	4: 86,825,512	G1197E	probably damaging	Het
Dnah10	T	C	5: 124,808,729	F2969L	probably benign	Het
Dnaic1	A	G	4: 41,625,281	K415R	probably benign	Het
Dnmbp	T	A	19: 43,854,171	T1253S	probably benign	Het
Dsp	T	C	13: 38,195,702	L1542P	possibly damaging	Het
Duox1	T	A	2: 122,340,201	L1234Q	probably damaging	Het
Efr3b	T	A	12: 3,968,590	R585S	possibly damaging	Het
Gpt	A	G	15: 76,699,352		probably null	Het
Heatr6	G	A	11: 83,753,718		probably benign	Het
Kcns2	A	G	15: 34,839,784	D431G	probably benign	Het
Kdm3b	A	G	18: 34,829,289	N1543D	probably damaging	Het
Man2a1	A	G	17: 64,625,380	K154R	probably benign	Het
Mical3	G	A	6: 120,958,271	Q893*	probably null	Het
Morc3	C	T	16: 93,866,453	H515Y	possibly damaging	Het
Mprip	A	T	11: 59,757,721	R750S	probably damaging	Het
Mroh1	G	A	15: 76,451,491	V1436M	probably benign	Het
Muc5ac	C	T	7: 141,790,669	R69*	probably null	Het
Muc5b	A	T	7: 141,856,712	Y1274F	unknown	Het
Mybpc1	A	G	10: 88,542,456	L674P	probably damaging	Het
Mypn	A	G	10: 63,131,023	V958A	probably benign	Het
Nipbl	T	C	15: 8,296,818	T2436A	probably benign	Het
Olfr835	A	G	9: 19,035,147	D8G	probably benign	Het
Pcdhb5	T	A	18: 37,321,773	L402Q	probably damaging	Het
Pigp	T	A	16: 94,370,194		probably null	Het
Rp1	A	G	1: 4,348,462	L809P	probably benign	Het
Scn3a	T	A	2: 65,494,781		probably benign	Het
Sdf2	A	T	11: 78,246,080	M29L	probably benign	Het
Serpina3b	T	G	12: 104,134,091	L311V	possibly damaging	Het
Snx31	A	T	15: 36,523,488	Y349*	probably null	Het
Spidr	A	C	16: 16,114,869	C182W	probably damaging	Het
St13	A	T	15: 81,377,798	S146R	probably damaging	Het
St8sia4	A	G	1: 95,653,582	V145A	probably damaging	Het
Tcp11l2	T	A	10: 84,594,797		probably benign	Het
Tfdp2	C	T	9: 96,317,574	P74S	unknown	Het
Tmprss15	C	T	16: 79,057,659	R287H	probably benign	Het
Trav10d	T	C	14: 52,811,322	Y57H	probably damaging	Het
Vmn2r104	A	G	17: 20,029,471	I846T	probably benign	Het
Ywhah	T	A	5: 33,026,948	M165K	possibly damaging	Het
Zfp324	C	A	7: 12,969,366	P72T	probably benign	Het

Other mutations in Stradb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00784:Stradb	APN	1	58988529	missense	probably damaging	0.98
IGL00843:Stradb	APN	1	58994409	missense	probably benign
IGL01288:Stradb	APN	1	58992301	missense	possibly damaging	0.61
IGL02045:Stradb	APN	1	58989778	missense	probably damaging	1.00
IGL02818:Stradb	APN	1	58979962	missense	probably damaging	0.99
P0047:Stradb	UTSW	1	58989798	missense	probably null	0.86
R0739:Stradb	UTSW	1	58977015	unclassified	probably benign
R0970:Stradb	UTSW	1	58977060	missense	possibly damaging	0.92
R1809:Stradb	UTSW	1	58994390	missense	possibly damaging	0.54
R1930:Stradb	UTSW	1	58991105	missense	probably benign	0.07
R1931:Stradb	UTSW	1	58991105	missense	probably benign	0.07
R1932:Stradb	UTSW	1	58991105	missense	probably benign	0.07
R2570:Stradb	UTSW	1	58988584	missense	probably damaging	1.00
R2919:Stradb	UTSW	1	58992669	missense	probably benign	0.44
R3104:Stradb	UTSW	1	58992291	missense	possibly damaging	0.86
R3105:Stradb	UTSW	1	58992291	missense	possibly damaging	0.86
R3106:Stradb	UTSW	1	58992291	missense	possibly damaging	0.86
R3772:Stradb	UTSW	1	58985385	missense	probably benign	0.04
R4120:Stradb	UTSW	1	58980009	missense	possibly damaging	0.92
R4417:Stradb	UTSW	1	58994372	missense	probably benign
R4569:Stradb	UTSW	1	58979958	nonsense	probably null
R4601:Stradb	UTSW	1	58993572	missense	probably damaging	0.98
R4758:Stradb	UTSW	1	58988571	missense	probably benign	0.02
R4786:Stradb	UTSW	1	58991208	intron	probably benign
R4944:Stradb	UTSW	1	58980440	missense	probably benign	0.27
R5113:Stradb	UTSW	1	58991174	intron	probably benign
R5568:Stradb	UTSW	1	58992742	missense	possibly damaging	0.72
R5765:Stradb	UTSW	1	58992744	missense	probably benign	0.31
R6234:Stradb	UTSW	1	58988548	missense	probably damaging	1.00
R7411:Stradb	UTSW	1	58988518	missense	possibly damaging	0.95
R7511:Stradb	UTSW	1	58992949	missense	probably damaging	0.97
R7569:Stradb	UTSW	1	58991151	missense	unknown
R7575:Stradb	UTSW	1	58988580	missense	probably benign	0.00
R7646:Stradb	UTSW	1	58994408	missense	probably benign	0.14
R7658:Stradb	UTSW	1	58992726	missense	probably damaging	0.96
R8306:Stradb	UTSW	1	58991197	missense	unknown
R8812:Stradb	UTSW	1	58994319	missense	probably benign	0.16
Z1176:Stradb	UTSW	1	58992999	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGATTCTGCTTCCAGCCCAG -3'
(R):5'- TAATCAACCATGTTCCTCTCAGAAC -3'

Sequencing Primer
(F):5'- GATCCTGGGTCTTTCGTATACACAAG -3'
(R):5'- AAGCTCCAGGACAGCGTG -3'

Posted On

2017-03-31