Incidental Mutation 'R5970:Cry2'
ID470787
Institutional Source Beutler Lab
Gene Symbol Cry2
Ensembl Gene ENSMUSG00000068742
Gene Namecryptochrome 2 (photolyase-like)
Synonyms
MMRRC Submission 044153-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.743) question?
Stock #R5970 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location92403646-92434043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92412967 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 510 (S510P)
Ref Sequence ENSEMBL: ENSMUSP00000106909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090559] [ENSMUST00000111278]
Predicted Effect probably benign
Transcript: ENSMUST00000090559
AA Change: S510P

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000088047
Gene: ENSMUSG00000068742
AA Change: S510P

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 187 2.4e-50 PFAM
Pfam:FAD_binding_7 231 504 4.4e-89 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111278
AA Change: S510P

PolyPhen 2 Score 0.079 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000106909
Gene: ENSMUSG00000068742
AA Change: S510P

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 189 3.6e-50 PFAM
Pfam:FAD_binding_7 230 506 1.4e-105 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126002
Meta Mutation Damage Score 0.1826 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour longer circadian period under constant darkness, and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,597,046 probably benign Het
Ambn T C 5: 88,467,951 V413A possibly damaging Het
Amotl1 T A 9: 14,596,528 D41V probably damaging Het
Arhgef26 T C 3: 62,340,047 V184A probably benign Het
Birc6 G T 17: 74,618,502 G936V possibly damaging Het
Ccser1 T A 6: 61,311,242 S130T possibly damaging Het
Cecr2 A G 6: 120,720,907 I56V probably damaging Het
Cfap52 A G 11: 67,930,744 I486T probably damaging Het
Col4a3 A G 1: 82,716,329 I1557V possibly damaging Het
Col6a5 T A 9: 105,945,847 I104F unknown Het
Csmd2 G C 4: 128,546,151 A3133P probably benign Het
Cyld G T 8: 88,732,993 A611S probably damaging Het
Dennd4c G A 4: 86,825,512 G1197E probably damaging Het
Dnah10 T C 5: 124,808,729 F2969L probably benign Het
Dnaic1 A G 4: 41,625,281 K415R probably benign Het
Dnmbp T A 19: 43,854,171 T1253S probably benign Het
Dsp T C 13: 38,195,702 L1542P possibly damaging Het
Duox1 T A 2: 122,340,201 L1234Q probably damaging Het
Efr3b T A 12: 3,968,590 R585S possibly damaging Het
Gpt A G 15: 76,699,352 probably null Het
Heatr6 G A 11: 83,753,718 probably benign Het
Kcns2 A G 15: 34,839,784 D431G probably benign Het
Kdm3b A G 18: 34,829,289 N1543D probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mical3 G A 6: 120,958,271 Q893* probably null Het
Morc3 C T 16: 93,866,453 H515Y possibly damaging Het
Mprip A T 11: 59,757,721 R750S probably damaging Het
Mroh1 G A 15: 76,451,491 V1436M probably benign Het
Muc5ac C T 7: 141,790,669 R69* probably null Het
Muc5b A T 7: 141,856,712 Y1274F unknown Het
Mybpc1 A G 10: 88,542,456 L674P probably damaging Het
Mypn A G 10: 63,131,023 V958A probably benign Het
Nipbl T C 15: 8,296,818 T2436A probably benign Het
Olfr835 A G 9: 19,035,147 D8G probably benign Het
Pcdhb5 T A 18: 37,321,773 L402Q probably damaging Het
Pigp T A 16: 94,370,194 probably null Het
Rp1 A G 1: 4,348,462 L809P probably benign Het
Scn3a T A 2: 65,494,781 probably benign Het
Sdf2 A T 11: 78,246,080 M29L probably benign Het
Serpina3b T G 12: 104,134,091 L311V possibly damaging Het
Snx31 A T 15: 36,523,488 Y349* probably null Het
Spidr A C 16: 16,114,869 C182W probably damaging Het
St13 A T 15: 81,377,798 S146R probably damaging Het
St8sia4 A G 1: 95,653,582 V145A probably damaging Het
Stradb T C 1: 58,980,016 probably null Het
Tcp11l2 T A 10: 84,594,797 probably benign Het
Tfdp2 C T 9: 96,317,574 P74S unknown Het
Tmprss15 C T 16: 79,057,659 R287H probably benign Het
Trav10d T C 14: 52,811,322 Y57H probably damaging Het
Vmn2r104 A G 17: 20,029,471 I846T probably benign Het
Ywhah T A 5: 33,026,948 M165K possibly damaging Het
Zfp324 C A 7: 12,969,366 P72T probably benign Het
Other mutations in Cry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cry2 APN 2 92424632 missense probably benign 0.15
IGL02167:Cry2 APN 2 92433821 missense possibly damaging 0.93
IGL02183:Cry2 APN 2 92413039 missense probably damaging 0.99
IGL02343:Cry2 APN 2 92426921 missense possibly damaging 0.90
IGL02432:Cry2 APN 2 92413667 missense probably damaging 0.99
IGL02725:Cry2 APN 2 92413260 splice site probably benign
IGL02932:Cry2 APN 2 92413117 nonsense probably null
IGL03122:Cry2 APN 2 92413295 missense probably damaging 1.00
IGL03366:Cry2 APN 2 92413715 missense probably damaging 1.00
R0679:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R1325:Cry2 UTSW 2 92413770 missense probably damaging 1.00
R1862:Cry2 UTSW 2 92424566 missense probably damaging 1.00
R1891:Cry2 UTSW 2 92413640 missense possibly damaging 0.93
R2189:Cry2 UTSW 2 92411692 missense possibly damaging 0.84
R4032:Cry2 UTSW 2 92413827 missense probably benign 0.00
R4689:Cry2 UTSW 2 92424554 missense probably benign 0.38
R5130:Cry2 UTSW 2 92424599 missense probably benign 0.28
R5145:Cry2 UTSW 2 92413060 missense probably benign
R6179:Cry2 UTSW 2 92413842 missense probably damaging 0.98
R7102:Cry2 UTSW 2 92413093 missense probably damaging 0.99
R7158:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R7213:Cry2 UTSW 2 92413659 missense probably benign 0.00
R7257:Cry2 UTSW 2 92412981 missense possibly damaging 0.67
R7378:Cry2 UTSW 2 92413664 missense probably damaging 1.00
R7427:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7428:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7440:Cry2 UTSW 2 92413638 missense probably damaging 1.00
R7531:Cry2 UTSW 2 92413005 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TAAGAGGGCTGCAGATCATG -3'
(R):5'- ACTGAAAGGCTTCCCCTCTC -3'

Sequencing Primer
(F):5'- GGGCTGCAGATCATGAGAAAC -3'
(R):5'- CGATACATCTATGAGCCCTGGAATG -3'
Posted On2017-03-31