Incidental Mutation 'R5970:Dennd4c'
ID470790
Institutional Source Beutler Lab
Gene Symbol Dennd4c
Ensembl Gene ENSMUSG00000038024
Gene NameDENN/MADD domain containing 4C
Synonyms1700065A05Rik
MMRRC Submission 044153-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5970 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location86748555-86850603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86825512 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 1197 (G1197E)
Ref Sequence ENSEMBL: ENSMUSP00000123367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045512] [ENSMUST00000082026] [ENSMUST00000142837]
Predicted Effect probably damaging
Transcript: ENSMUST00000045512
AA Change: G1246E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039860
Gene: ENSMUSG00000038024
AA Change: G1246E

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.15e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000082026
AA Change: G1246E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080685
Gene: ENSMUSG00000038024
AA Change: G1246E

DomainStartEndE-ValueType
internal_repeat_1 43 91 3.19e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1045 1052 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1175 1186 N/A INTRINSIC
low complexity region 1377 1392 N/A INTRINSIC
low complexity region 1472 1486 N/A INTRINSIC
low complexity region 1724 1739 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142837
AA Change: G1197E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123367
Gene: ENSMUSG00000038024
AA Change: G1197E

DomainStartEndE-ValueType
internal_repeat_1 43 91 2.68e-5 PROSPERO
uDENN 168 275 3.96e-24 SMART
DENN 307 491 7.16e-72 SMART
dDENN 557 631 1.85e-24 SMART
low complexity region 934 952 N/A INTRINSIC
low complexity region 964 976 N/A INTRINSIC
low complexity region 996 1003 N/A INTRINSIC
low complexity region 1053 1064 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
low complexity region 1328 1343 N/A INTRINSIC
low complexity region 1423 1437 N/A INTRINSIC
low complexity region 1675 1690 N/A INTRINSIC
Meta Mutation Damage Score 0.2108 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,597,046 probably benign Het
Ambn T C 5: 88,467,951 V413A possibly damaging Het
Amotl1 T A 9: 14,596,528 D41V probably damaging Het
Arhgef26 T C 3: 62,340,047 V184A probably benign Het
Birc6 G T 17: 74,618,502 G936V possibly damaging Het
Ccser1 T A 6: 61,311,242 S130T possibly damaging Het
Cecr2 A G 6: 120,720,907 I56V probably damaging Het
Cfap52 A G 11: 67,930,744 I486T probably damaging Het
Col4a3 A G 1: 82,716,329 I1557V possibly damaging Het
Col6a5 T A 9: 105,945,847 I104F unknown Het
Cry2 A G 2: 92,412,967 S510P probably benign Het
Csmd2 G C 4: 128,546,151 A3133P probably benign Het
Cyld G T 8: 88,732,993 A611S probably damaging Het
Dnah10 T C 5: 124,808,729 F2969L probably benign Het
Dnaic1 A G 4: 41,625,281 K415R probably benign Het
Dnmbp T A 19: 43,854,171 T1253S probably benign Het
Dsp T C 13: 38,195,702 L1542P possibly damaging Het
Duox1 T A 2: 122,340,201 L1234Q probably damaging Het
Efr3b T A 12: 3,968,590 R585S possibly damaging Het
Gpt A G 15: 76,699,352 probably null Het
Heatr6 G A 11: 83,753,718 probably benign Het
Kcns2 A G 15: 34,839,784 D431G probably benign Het
Kdm3b A G 18: 34,829,289 N1543D probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mical3 G A 6: 120,958,271 Q893* probably null Het
Morc3 C T 16: 93,866,453 H515Y possibly damaging Het
Mprip A T 11: 59,757,721 R750S probably damaging Het
Mroh1 G A 15: 76,451,491 V1436M probably benign Het
Muc5ac C T 7: 141,790,669 R69* probably null Het
Muc5b A T 7: 141,856,712 Y1274F unknown Het
Mybpc1 A G 10: 88,542,456 L674P probably damaging Het
Mypn A G 10: 63,131,023 V958A probably benign Het
Nipbl T C 15: 8,296,818 T2436A probably benign Het
Olfr835 A G 9: 19,035,147 D8G probably benign Het
Pcdhb5 T A 18: 37,321,773 L402Q probably damaging Het
Pigp T A 16: 94,370,194 probably null Het
Rp1 A G 1: 4,348,462 L809P probably benign Het
Scn3a T A 2: 65,494,781 probably benign Het
Sdf2 A T 11: 78,246,080 M29L probably benign Het
Serpina3b T G 12: 104,134,091 L311V possibly damaging Het
Snx31 A T 15: 36,523,488 Y349* probably null Het
Spidr A C 16: 16,114,869 C182W probably damaging Het
St13 A T 15: 81,377,798 S146R probably damaging Het
St8sia4 A G 1: 95,653,582 V145A probably damaging Het
Stradb T C 1: 58,980,016 probably null Het
Tcp11l2 T A 10: 84,594,797 probably benign Het
Tfdp2 C T 9: 96,317,574 P74S unknown Het
Tmprss15 C T 16: 79,057,659 R287H probably benign Het
Trav10d T C 14: 52,811,322 Y57H probably damaging Het
Vmn2r104 A G 17: 20,029,471 I846T probably benign Het
Ywhah T A 5: 33,026,948 M165K possibly damaging Het
Zfp324 C A 7: 12,969,366 P72T probably benign Het
Other mutations in Dennd4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Dennd4c APN 4 86805487 splice site probably benign
IGL01810:Dennd4c APN 4 86799551 missense possibly damaging 0.94
IGL02203:Dennd4c APN 4 86802936 missense probably benign 0.00
IGL02217:Dennd4c APN 4 86813799 missense probably benign
IGL02236:Dennd4c APN 4 86807435 missense possibly damaging 0.68
IGL02256:Dennd4c APN 4 86799541 missense probably damaging 0.96
IGL02396:Dennd4c APN 4 86825000 missense probably damaging 1.00
IGL02523:Dennd4c APN 4 86774253 unclassified probably benign
IGL02615:Dennd4c APN 4 86821467 missense probably benign 0.00
IGL03069:Dennd4c APN 4 86774437 nonsense probably null
IGL03116:Dennd4c APN 4 86788820 splice site probably benign
IGL03117:Dennd4c APN 4 86777903 missense possibly damaging 0.95
IGL03273:Dennd4c APN 4 86777796 missense probably damaging 1.00
IGL03329:Dennd4c APN 4 86777876 missense probably damaging 1.00
IGL03365:Dennd4c APN 4 86807426 critical splice acceptor site probably null
PIT4486001:Dennd4c UTSW 4 86799464 nonsense probably null
R0010:Dennd4c UTSW 4 86781577 missense probably damaging 1.00
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0032:Dennd4c UTSW 4 86828150 critical splice donor site probably null
R0092:Dennd4c UTSW 4 86781607 missense probably damaging 1.00
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0103:Dennd4c UTSW 4 86812446 missense probably benign 0.07
R0511:Dennd4c UTSW 4 86826022 missense probably damaging 1.00
R0515:Dennd4c UTSW 4 86813466 missense possibly damaging 0.94
R0578:Dennd4c UTSW 4 86812422 missense probably damaging 1.00
R0759:Dennd4c UTSW 4 86788829 missense probably damaging 1.00
R0784:Dennd4c UTSW 4 86844908 missense probably benign 0.37
R1156:Dennd4c UTSW 4 86807466 missense probably damaging 1.00
R1370:Dennd4c UTSW 4 86811510 missense probably damaging 1.00
R1381:Dennd4c UTSW 4 86774532 missense probably benign 0.24
R1569:Dennd4c UTSW 4 86786094 missense possibly damaging 0.59
R1747:Dennd4c UTSW 4 86807438 missense probably damaging 1.00
R1764:Dennd4c UTSW 4 86803010 missense probably damaging 1.00
R1838:Dennd4c UTSW 4 86825178 missense probably benign 0.00
R1997:Dennd4c UTSW 4 86837397 missense probably benign
R2244:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R2348:Dennd4c UTSW 4 86811527 missense probably benign 0.04
R2968:Dennd4c UTSW 4 86781644 missense possibly damaging 0.93
R3033:Dennd4c UTSW 4 86825320 small deletion probably benign
R3401:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3402:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3403:Dennd4c UTSW 4 86774543 missense probably damaging 1.00
R3855:Dennd4c UTSW 4 86779847 missense probably damaging 1.00
R3939:Dennd4c UTSW 4 86774280 missense probably damaging 1.00
R4164:Dennd4c UTSW 4 86807527 missense probably benign 0.01
R4384:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R4435:Dennd4c UTSW 4 86798075 missense probably benign 0.44
R4788:Dennd4c UTSW 4 86819963 missense probably benign 0.00
R4801:Dennd4c UTSW 4 86819884 nonsense probably null
R4802:Dennd4c UTSW 4 86819884 nonsense probably null
R4818:Dennd4c UTSW 4 86825274 missense probably benign 0.00
R4923:Dennd4c UTSW 4 86807538 missense probably damaging 1.00
R4958:Dennd4c UTSW 4 86781679 missense probably damaging 1.00
R5025:Dennd4c UTSW 4 86795299 critical splice donor site probably null
R5434:Dennd4c UTSW 4 86811456 missense probably benign 0.10
R5662:Dennd4c UTSW 4 86795288 missense probably benign 0.13
R5802:Dennd4c UTSW 4 86811453 missense probably benign 0.02
R5849:Dennd4c UTSW 4 86825986 missense possibly damaging 0.58
R5861:Dennd4c UTSW 4 86791352 missense probably benign 0.30
R6163:Dennd4c UTSW 4 86805591 missense possibly damaging 0.56
R6356:Dennd4c UTSW 4 86825449 missense probably benign
R6661:Dennd4c UTSW 4 86799389 missense possibly damaging 0.66
R6855:Dennd4c UTSW 4 86836457 missense probably benign
R6983:Dennd4c UTSW 4 86799493 missense probably damaging 1.00
R7035:Dennd4c UTSW 4 86812337 missense probably damaging 1.00
R7126:Dennd4c UTSW 4 86807430 missense probably damaging 1.00
R7185:Dennd4c UTSW 4 86811450 missense probably damaging 1.00
R7212:Dennd4c UTSW 4 86802991 missense probably damaging 1.00
R7324:Dennd4c UTSW 4 86829738 missense unknown
R7329:Dennd4c UTSW 4 86779874 missense possibly damaging 0.81
R7329:Dennd4c UTSW 4 86841081 missense probably damaging 1.00
R7466:Dennd4c UTSW 4 86774331 missense probably damaging 0.99
R7479:Dennd4c UTSW 4 86799353 missense probably damaging 1.00
R7538:Dennd4c UTSW 4 86774516 missense probably damaging 1.00
R7599:Dennd4c UTSW 4 86811612 missense probably damaging 1.00
R7688:Dennd4c UTSW 4 86795140 missense probably damaging 1.00
R7725:Dennd4c UTSW 4 86786093 missense probably benign 0.00
R7751:Dennd4c UTSW 4 86828942 missense probably benign 0.05
R7790:Dennd4c UTSW 4 86799517 missense probably damaging 0.96
R8056:Dennd4c UTSW 4 86844976 missense probably null 0.71
Predicted Primers PCR Primer
(F):5'- TCCTGTGCTAGAGATGCTGG -3'
(R):5'- AGCTCTTCTCAGTCTCGGTG -3'

Sequencing Primer
(F):5'- CTGTGCTAGAGATGCTGGAGGAAAG -3'
(R):5'- GCAGACTCGAGCTCCTTTCTAAAG -3'
Posted On2017-03-31