Incidental Mutation 'R5970:Ccser1'
ID 470795
Institutional Source Beutler Lab
Gene Symbol Ccser1
Ensembl Gene ENSMUSG00000039578
Gene Name coiled-coil serine rich 1
Synonyms 6230405M12Rik, Fam190a, C130092O11Rik
MMRRC Submission 044153-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.145) question?
Stock # R5970 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 61157308-62359849 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 61288226 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 130 (S130T)
Ref Sequence ENSEMBL: ENSMUSP00000122894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045522] [ENSMUST00000126214]
AlphaFold Q8C0C4
Predicted Effect possibly damaging
Transcript: ENSMUST00000045522
AA Change: S130T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040251
Gene: ENSMUSG00000039578
AA Change: S130T

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126214
AA Change: S130T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122894
Gene: ENSMUSG00000039578
AA Change: S130T

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
low complexity region 510 525 N/A INTRINSIC
low complexity region 645 659 N/A INTRINSIC
coiled coil region 674 703 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131989
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147576
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,574,028 (GRCm39) probably benign Het
Ambn T C 5: 88,615,810 (GRCm39) V413A possibly damaging Het
Amotl1 T A 9: 14,507,824 (GRCm39) D41V probably damaging Het
Arhgef26 T C 3: 62,247,468 (GRCm39) V184A probably benign Het
Birc6 G T 17: 74,925,497 (GRCm39) G936V possibly damaging Het
Cecr2 A G 6: 120,697,868 (GRCm39) I56V probably damaging Het
Cfap52 A G 11: 67,821,570 (GRCm39) I486T probably damaging Het
Col4a3 A G 1: 82,694,050 (GRCm39) I1557V possibly damaging Het
Col6a5 T A 9: 105,823,046 (GRCm39) I104F unknown Het
Cry2 A G 2: 92,243,312 (GRCm39) S510P probably benign Het
Csmd2 G C 4: 128,439,944 (GRCm39) A3133P probably benign Het
Cyld G T 8: 89,459,621 (GRCm39) A611S probably damaging Het
Dennd4c G A 4: 86,743,749 (GRCm39) G1197E probably damaging Het
Dnah10 T C 5: 124,885,793 (GRCm39) F2969L probably benign Het
Dnai1 A G 4: 41,625,281 (GRCm39) K415R probably benign Het
Dnmbp T A 19: 43,842,610 (GRCm39) T1253S probably benign Het
Dsp T C 13: 38,379,678 (GRCm39) L1542P possibly damaging Het
Duox1 T A 2: 122,170,682 (GRCm39) L1234Q probably damaging Het
Efr3b T A 12: 4,018,590 (GRCm39) R585S possibly damaging Het
Gpt A G 15: 76,583,552 (GRCm39) probably null Het
Heatr6 G A 11: 83,644,544 (GRCm39) probably benign Het
Kcns2 A G 15: 34,839,930 (GRCm39) D431G probably benign Het
Kdm3b A G 18: 34,962,342 (GRCm39) N1543D probably damaging Het
Man2a1 A G 17: 64,932,375 (GRCm39) K154R probably benign Het
Mical3 G A 6: 120,935,232 (GRCm39) Q893* probably null Het
Morc3 C T 16: 93,663,341 (GRCm39) H515Y possibly damaging Het
Mprip A T 11: 59,648,547 (GRCm39) R750S probably damaging Het
Mroh1 G A 15: 76,335,691 (GRCm39) V1436M probably benign Het
Muc5ac C T 7: 141,344,406 (GRCm39) R69* probably null Het
Muc5b A T 7: 141,410,449 (GRCm39) Y1274F unknown Het
Mybpc1 A G 10: 88,378,318 (GRCm39) L674P probably damaging Het
Mypn A G 10: 62,966,802 (GRCm39) V958A probably benign Het
Nipbl T C 15: 8,326,302 (GRCm39) T2436A probably benign Het
Or7g20 A G 9: 18,946,443 (GRCm39) D8G probably benign Het
Pcdhb5 T A 18: 37,454,826 (GRCm39) L402Q probably damaging Het
Pigp T A 16: 94,171,053 (GRCm39) probably null Het
Rp1 A G 1: 4,418,685 (GRCm39) L809P probably benign Het
Scn3a T A 2: 65,325,125 (GRCm39) probably benign Het
Sdf2 A T 11: 78,136,906 (GRCm39) M29L probably benign Het
Serpina3b T G 12: 104,100,350 (GRCm39) L311V possibly damaging Het
Snx31 A T 15: 36,523,634 (GRCm39) Y349* probably null Het
Spidr A C 16: 15,932,733 (GRCm39) C182W probably damaging Het
St13 A T 15: 81,261,999 (GRCm39) S146R probably damaging Het
St8sia4 A G 1: 95,581,307 (GRCm39) V145A probably damaging Het
Stradb T C 1: 59,019,175 (GRCm39) probably null Het
Tcp11l2 T A 10: 84,430,661 (GRCm39) probably benign Het
Tfdp2 C T 9: 96,199,627 (GRCm39) P74S unknown Het
Tmprss15 C T 16: 78,854,547 (GRCm39) R287H probably benign Het
Trav10d T C 14: 53,048,779 (GRCm39) Y57H probably damaging Het
Vmn2r104 A G 17: 20,249,733 (GRCm39) I846T probably benign Het
Ywhah T A 5: 33,184,292 (GRCm39) M165K possibly damaging Het
Zfp324 C A 7: 12,703,293 (GRCm39) P72T probably benign Het
Other mutations in Ccser1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Ccser1 APN 6 62,357,126 (GRCm39) missense possibly damaging 0.80
IGL00858:Ccser1 APN 6 61,787,649 (GRCm39) nonsense probably null
IGL01012:Ccser1 APN 6 61,615,474 (GRCm39) missense probably benign 0.01
IGL01391:Ccser1 APN 6 61,615,505 (GRCm39) splice site probably benign
IGL01643:Ccser1 APN 6 61,288,839 (GRCm39) missense probably benign 0.01
IGL01767:Ccser1 APN 6 61,695,136 (GRCm39) missense probably benign 0.03
IGL02081:Ccser1 APN 6 61,288,152 (GRCm39) nonsense probably null
IGL02152:Ccser1 APN 6 61,288,692 (GRCm39) missense possibly damaging 0.57
IGL02870:Ccser1 APN 6 61,288,276 (GRCm39) missense probably damaging 0.99
IGL02890:Ccser1 APN 6 62,356,815 (GRCm39) missense probably damaging 0.99
IGL03147:Ccser1 UTSW 6 61,289,144 (GRCm39) missense probably benign 0.02
R0020:Ccser1 UTSW 6 61,290,788 (GRCm39) missense possibly damaging 0.62
R0831:Ccser1 UTSW 6 61,400,045 (GRCm39) missense probably damaging 0.99
R1306:Ccser1 UTSW 6 62,357,090 (GRCm39) missense probably damaging 0.99
R1441:Ccser1 UTSW 6 62,357,016 (GRCm39) missense probably benign 0.00
R1650:Ccser1 UTSW 6 61,615,474 (GRCm39) missense probably benign 0.01
R1653:Ccser1 UTSW 6 61,288,449 (GRCm39) missense probably benign 0.00
R1913:Ccser1 UTSW 6 62,356,878 (GRCm39) missense probably damaging 0.99
R1961:Ccser1 UTSW 6 61,290,630 (GRCm39) splice site probably benign
R2030:Ccser1 UTSW 6 61,288,547 (GRCm39) missense probably benign
R2056:Ccser1 UTSW 6 61,399,936 (GRCm39) splice site probably null
R2268:Ccser1 UTSW 6 61,547,827 (GRCm39) missense probably damaging 1.00
R2280:Ccser1 UTSW 6 61,547,799 (GRCm39) missense probably damaging 1.00
R2281:Ccser1 UTSW 6 61,547,799 (GRCm39) missense probably damaging 1.00
R2571:Ccser1 UTSW 6 61,399,944 (GRCm39) missense probably damaging 1.00
R4606:Ccser1 UTSW 6 61,288,568 (GRCm39) missense probably damaging 0.99
R4711:Ccser1 UTSW 6 61,288,910 (GRCm39) missense possibly damaging 0.74
R4770:Ccser1 UTSW 6 61,288,485 (GRCm39) missense possibly damaging 0.85
R4932:Ccser1 UTSW 6 61,695,175 (GRCm39) missense possibly damaging 0.78
R5078:Ccser1 UTSW 6 61,288,350 (GRCm39) missense probably damaging 0.97
R5097:Ccser1 UTSW 6 61,289,144 (GRCm39) missense probably benign 0.02
R5221:Ccser1 UTSW 6 61,289,075 (GRCm39) missense probably damaging 0.99
R5378:Ccser1 UTSW 6 61,288,650 (GRCm39) missense probably benign 0.00
R5604:Ccser1 UTSW 6 61,290,788 (GRCm39) missense probably damaging 0.97
R5700:Ccser1 UTSW 6 61,288,260 (GRCm39) missense probably benign 0.00
R6257:Ccser1 UTSW 6 62,356,769 (GRCm39) missense probably benign
R6257:Ccser1 UTSW 6 61,350,946 (GRCm39) missense probably damaging 0.96
R6375:Ccser1 UTSW 6 61,288,152 (GRCm39) nonsense probably null
R6703:Ccser1 UTSW 6 61,615,495 (GRCm39) nonsense probably null
R6930:Ccser1 UTSW 6 62,357,009 (GRCm39) missense probably benign 0.03
R7256:Ccser1 UTSW 6 61,288,851 (GRCm39) missense probably benign 0.38
R7362:Ccser1 UTSW 6 61,787,864 (GRCm39) missense unknown
R7508:Ccser1 UTSW 6 61,547,707 (GRCm39) missense probably benign 0.05
R7532:Ccser1 UTSW 6 62,356,915 (GRCm39) nonsense probably null
R7533:Ccser1 UTSW 6 61,615,474 (GRCm39) missense probably benign 0.25
R7729:Ccser1 UTSW 6 61,288,840 (GRCm39) missense probably benign
R7875:Ccser1 UTSW 6 61,288,932 (GRCm39) missense probably benign 0.06
R8055:Ccser1 UTSW 6 61,290,757 (GRCm39) missense possibly damaging 0.47
R8396:Ccser1 UTSW 6 61,289,088 (GRCm39) missense probably benign 0.09
R8724:Ccser1 UTSW 6 61,288,199 (GRCm39) missense probably damaging 0.99
R8849:Ccser1 UTSW 6 61,288,537 (GRCm39) missense probably benign 0.00
R8906:Ccser1 UTSW 6 61,787,842 (GRCm39) missense probably benign 0.00
R9058:Ccser1 UTSW 6 61,350,976 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTTCCACCATAAGAAGGG -3'
(R):5'- AGTGGATTGGCTCTGAGGAAC -3'

Sequencing Primer
(F):5'- CTTCCACCATAAGAAGGGCAGTG -3'
(R):5'- ATTGGCTCTGAGGAACCGACTTAC -3'
Posted On 2017-03-31