Mutagenetix > Incidental Mutation

Incidental Mutation 'R5970:Cecr2'

470797

Institutional Source

Beutler Lab

Gene Symbol

Cecr2

Ensembl Gene

ENSMUSG00000071226

Gene Name

CECR2, histone acetyl-lysine reader

Synonyms

Gtl4, 2610101O16Rik, 2810409N01Rik

MMRRC Submission

044153-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5970 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120666369-120771190 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120720907 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 56 (I56V)

Ref Sequence

ENSEMBL: ENSMUSP00000108306 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100993] [ENSMUST00000112686]

AlphaFold

E9Q2Z1

Predicted Effect

probably damaging
Transcript: ENSMUST00000100993
AA Change: I56V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000098556
Gene: ENSMUSG00000071226
AA Change: I56V

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
Pfam:WHIM3	244	284	5.2e-11	PFAM
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	781	796	N/A	INTRINSIC
low complexity region	839	855	N/A	INTRINSIC
low complexity region	890	907	N/A	INTRINSIC
low complexity region	1173	1187	N/A	INTRINSIC
low complexity region	1202	1223	N/A	INTRINSIC
low complexity region	1355	1366	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112686
AA Change: I56V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108306
Gene: ENSMUSG00000071226
AA Change: I56V

Domain	Start	End	E-Value	Type
low complexity region	4	14	N/A	INTRINSIC
low complexity region	194	209	N/A	INTRINSIC
low complexity region	211	222	N/A	INTRINSIC
coiled coil region	322	382	N/A	INTRINSIC
BROMO	416	520	5.09e-32	SMART
low complexity region	536	551	N/A	INTRINSIC
low complexity region	753	768	N/A	INTRINSIC
low complexity region	811	827	N/A	INTRINSIC
low complexity region	862	879	N/A	INTRINSIC
low complexity region	1145	1159	N/A	INTRINSIC
low complexity region	1174	1195	N/A	INTRINSIC
low complexity region	1327	1338	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135109

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148346

Meta Mutation Damage Score

0.1189

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice display varied penetrance of exencephaly depending on genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1l1	G	A	6: 90,597,046		probably benign	Het
Ambn	T	C	5: 88,467,951	V413A	possibly damaging	Het
Amotl1	T	A	9: 14,596,528	D41V	probably damaging	Het
Arhgef26	T	C	3: 62,340,047	V184A	probably benign	Het
Birc6	G	T	17: 74,618,502	G936V	possibly damaging	Het
Ccser1	T	A	6: 61,311,242	S130T	possibly damaging	Het
Cfap52	A	G	11: 67,930,744	I486T	probably damaging	Het
Col4a3	A	G	1: 82,716,329	I1557V	possibly damaging	Het
Col6a5	T	A	9: 105,945,847	I104F	unknown	Het
Cry2	A	G	2: 92,412,967	S510P	probably benign	Het
Csmd2	G	C	4: 128,546,151	A3133P	probably benign	Het
Cyld	G	T	8: 88,732,993	A611S	probably damaging	Het
Dennd4c	G	A	4: 86,825,512	G1197E	probably damaging	Het
Dnah10	T	C	5: 124,808,729	F2969L	probably benign	Het
Dnaic1	A	G	4: 41,625,281	K415R	probably benign	Het
Dnmbp	T	A	19: 43,854,171	T1253S	probably benign	Het
Dsp	T	C	13: 38,195,702	L1542P	possibly damaging	Het
Duox1	T	A	2: 122,340,201	L1234Q	probably damaging	Het
Efr3b	T	A	12: 3,968,590	R585S	possibly damaging	Het
Gpt	A	G	15: 76,699,352		probably null	Het
Heatr6	G	A	11: 83,753,718		probably benign	Het
Kcns2	A	G	15: 34,839,784	D431G	probably benign	Het
Kdm3b	A	G	18: 34,829,289	N1543D	probably damaging	Het
Man2a1	A	G	17: 64,625,380	K154R	probably benign	Het
Mical3	G	A	6: 120,958,271	Q893*	probably null	Het
Morc3	C	T	16: 93,866,453	H515Y	possibly damaging	Het
Mprip	A	T	11: 59,757,721	R750S	probably damaging	Het
Mroh1	G	A	15: 76,451,491	V1436M	probably benign	Het
Muc5ac	C	T	7: 141,790,669	R69*	probably null	Het
Muc5b	A	T	7: 141,856,712	Y1274F	unknown	Het
Mybpc1	A	G	10: 88,542,456	L674P	probably damaging	Het
Mypn	A	G	10: 63,131,023	V958A	probably benign	Het
Nipbl	T	C	15: 8,296,818	T2436A	probably benign	Het
Olfr835	A	G	9: 19,035,147	D8G	probably benign	Het
Pcdhb5	T	A	18: 37,321,773	L402Q	probably damaging	Het
Pigp	T	A	16: 94,370,194		probably null	Het
Rp1	A	G	1: 4,348,462	L809P	probably benign	Het
Scn3a	T	A	2: 65,494,781		probably benign	Het
Sdf2	A	T	11: 78,246,080	M29L	probably benign	Het
Serpina3b	T	G	12: 104,134,091	L311V	possibly damaging	Het
Snx31	A	T	15: 36,523,488	Y349*	probably null	Het
Spidr	A	C	16: 16,114,869	C182W	probably damaging	Het
St13	A	T	15: 81,377,798	S146R	probably damaging	Het
St8sia4	A	G	1: 95,653,582	V145A	probably damaging	Het
Stradb	T	C	1: 58,980,016		probably null	Het
Tcp11l2	T	A	10: 84,594,797		probably benign	Het
Tfdp2	C	T	9: 96,317,574	P74S	unknown	Het
Tmprss15	C	T	16: 79,057,659	R287H	probably benign	Het
Trav10d	T	C	14: 52,811,322	Y57H	probably damaging	Het
Vmn2r104	A	G	17: 20,029,471	I846T	probably benign	Het
Ywhah	T	A	5: 33,026,948	M165K	possibly damaging	Het
Zfp324	C	A	7: 12,969,366	P72T	probably benign	Het

Other mutations in Cecr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00435:Cecr2	APN	6	120756717	missense	probably damaging	1.00
IGL00782:Cecr2	APN	6	120761621	missense	probably benign	0.00
IGL01137:Cecr2	APN	6	120762028	missense	probably damaging	1.00
IGL01446:Cecr2	APN	6	120758599	missense	probably benign
IGL02108:Cecr2	APN	6	120762558	critical splice donor site	probably null
IGL02195:Cecr2	APN	6	120731406	missense	probably damaging	1.00
IGL02689:Cecr2	APN	6	120762167	missense	probably damaging	1.00
IGL03189:Cecr2	APN	6	120762430	missense	probably benign	0.13
PIT1430001:Cecr2	UTSW	6	120758479	missense	probably benign	0.01
R0200:Cecr2	UTSW	6	120761797	missense	probably damaging	1.00
R0586:Cecr2	UTSW	6	120757884	missense	probably damaging	1.00
R0715:Cecr2	UTSW	6	120758198	missense	probably benign	0.21
R0784:Cecr2	UTSW	6	120758149	missense	possibly damaging	0.74
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1185:Cecr2	UTSW	6	120758205	nonsense	probably null
R1343:Cecr2	UTSW	6	120754711	missense	probably damaging	0.99
R1349:Cecr2	UTSW	6	120757603	missense	probably damaging	0.99
R1386:Cecr2	UTSW	6	120762131	missense	probably damaging	1.00
R1438:Cecr2	UTSW	6	120761472	nonsense	probably null
R1602:Cecr2	UTSW	6	120755587	missense	possibly damaging	0.52
R1664:Cecr2	UTSW	6	120762026	missense	probably damaging	0.96
R1731:Cecr2	UTSW	6	120758180	missense	possibly damaging	0.74
R1817:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1818:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1819:Cecr2	UTSW	6	120731267	missense	probably damaging	1.00
R1862:Cecr2	UTSW	6	120757941	missense	probably damaging	1.00
R1907:Cecr2	UTSW	6	120761160	missense	probably benign	0.03
R1911:Cecr2	UTSW	6	120762565	unclassified	probably benign
R2135:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00
R2273:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R2275:Cecr2	UTSW	6	120756741	missense	probably benign	0.00
R3713:Cecr2	UTSW	6	120758260	missense	probably damaging	1.00
R4271:Cecr2	UTSW	6	120762475	missense	probably damaging	1.00
R4706:Cecr2	UTSW	6	120755578	missense	possibly damaging	0.73
R4873:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R4875:Cecr2	UTSW	6	120750916	missense	probably damaging	0.99
R5137:Cecr2	UTSW	6	120755517	missense	probably benign
R5153:Cecr2	UTSW	6	120734560	missense	probably benign	0.03
R5377:Cecr2	UTSW	6	120756569	missense	possibly damaging	0.87
R5598:Cecr2	UTSW	6	120731446	splice site	probably null
R5651:Cecr2	UTSW	6	120755560	missense	probably damaging	0.96
R5680:Cecr2	UTSW	6	120761426	missense	probably benign
R5813:Cecr2	UTSW	6	120762208	missense	probably damaging	0.99
R6255:Cecr2	UTSW	6	120758050	missense	probably damaging	1.00
R6266:Cecr2	UTSW	6	120761686	missense	probably benign
R6630:Cecr2	UTSW	6	120762178	missense	probably damaging	1.00
R6737:Cecr2	UTSW	6	120737123	missense	possibly damaging	0.86
R6754:Cecr2	UTSW	6	120757578	missense	probably damaging	0.98
R6807:Cecr2	UTSW	6	120734542	splice site	probably null
R7187:Cecr2	UTSW	6	120756686	missense	probably benign
R7256:Cecr2	UTSW	6	120762529	missense	probably benign
R7282:Cecr2	UTSW	6	120761621	missense
R7548:Cecr2	UTSW	6	120761714	missense
R7596:Cecr2	UTSW	6	120762206	missense	probably benign
R7802:Cecr2	UTSW	6	120743847	missense	probably benign	0.45
R8112:Cecr2	UTSW	6	120762214	missense	probably benign	0.00
R8289:Cecr2	UTSW	6	120758116	missense	probably benign	0.24
R8294:Cecr2	UTSW	6	120733786	missense	probably damaging	0.99
R8470:Cecr2	UTSW	6	120756933	missense	probably benign	0.21
R8697:Cecr2	UTSW	6	120733818	missense	probably damaging	1.00
R8887:Cecr2	UTSW	6	120738201	missense	probably damaging	1.00
R9371:Cecr2	UTSW	6	120762268	missense	probably benign	0.01
R9416:Cecr2	UTSW	6	120758577	missense
R9477:Cecr2	UTSW	6	120743782	critical splice acceptor site	probably null
R9588:Cecr2	UTSW	6	120756809	missense	possibly damaging	0.87
X0012:Cecr2	UTSW	6	120733774	missense	probably damaging	0.99
X0063:Cecr2	UTSW	6	120762071	missense	probably benign	0.01
Z1177:Cecr2	UTSW	6	120720962	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCTGGTCAACTCACCTCG -3'
(R):5'- TCACAGGAATGTAGTGAAACCTG -3'

Sequencing Primer
(F):5'- GTTCCTGGGATTTGAACTCAGAACC -3'
(R):5'- TGAAACCTGATTTTAATTTGTTAGGC -3'

Posted On

2017-03-31