Incidental Mutation 'R0501:Adcy10'
ID 47080
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms soluble adenylyl cyclase, Sacy, 4930431D04Rik, sAC
MMRRC Submission 038696-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.255) question?
Stock # R0501 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 165312752-165404343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 165337959 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 191 (P191L)
Ref Sequence ENSEMBL: ENSMUSP00000137959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably damaging
Transcript: ENSMUST00000027852
AA Change: P191L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: P191L

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111439
AA Change: P191L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: P191L

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111440
AA Change: P191L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: P191L

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000148550
AA Change: P191L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: P191L

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155216
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000193149
AA Change: P143L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195194
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik T C 8: 73,209,216 (GRCm39) S415P probably benign Het
Adam19 C T 11: 46,013,957 (GRCm39) P316S probably damaging Het
Adamts2 A G 11: 50,558,972 (GRCm39) D229G probably benign Het
Adgrv1 T C 13: 81,707,269 (GRCm39) Y1379C probably damaging Het
Akap9 T C 5: 4,020,685 (GRCm39) L1132P probably damaging Het
Aoah A G 13: 21,189,243 (GRCm39) T489A probably benign Het
Apc2 T C 10: 80,150,958 (GRCm39) L1975P probably damaging Het
Bpifa5 A T 2: 154,005,616 (GRCm39) D66V probably benign Het
C230029F24Rik T C 1: 49,374,629 (GRCm39) noncoding transcript Het
Cacna1h A T 17: 25,607,641 (GRCm39) V892E probably damaging Het
Car4 G A 11: 84,854,268 (GRCm39) V72I probably benign Het
Cfap91 C G 16: 38,155,997 (GRCm39) M75I probably damaging Het
Chst3 A G 10: 60,022,049 (GRCm39) L266P probably damaging Het
Ckap2l G A 2: 129,127,411 (GRCm39) R256W possibly damaging Het
Cntn4 A T 6: 106,595,296 (GRCm39) D471V probably damaging Het
Cntrob G A 11: 69,213,694 (GRCm39) S32F probably damaging Het
Cpne7 T A 8: 123,852,994 (GRCm39) N200K possibly damaging Het
Creb3l3 C A 10: 80,922,416 (GRCm39) M271I probably benign Het
Csmd1 T A 8: 17,077,339 (GRCm39) Q106L probably damaging Het
D7Ertd443e G A 7: 133,896,701 (GRCm39) T563I probably damaging Het
Dmac1 T G 4: 75,196,413 (GRCm39) N26H unknown Het
Dop1b T C 16: 93,549,750 (GRCm39) F230L probably benign Het
Dpp6 T A 5: 27,930,604 (GRCm39) I812N probably damaging Het
Fabp12 T C 3: 10,315,203 (GRCm39) D48G probably benign Het
Fbn1 G A 2: 125,143,669 (GRCm39) T2820M probably benign Het
Fcho1 C T 8: 72,165,204 (GRCm39) A418T probably benign Het
Fcho2 A T 13: 98,901,023 (GRCm39) S277R possibly damaging Het
Fmo2 A G 1: 162,704,497 (GRCm39) S470P probably benign Het
Gm17541 T G 12: 4,739,730 (GRCm39) probably benign Het
Gm4353 A T 7: 115,682,706 (GRCm39) Y292N probably benign Het
Igkv4-71 A T 6: 69,220,290 (GRCm39) I69N probably damaging Het
Insrr G T 3: 87,717,991 (GRCm39) A871S probably benign Het
Irs2 C T 8: 11,056,396 (GRCm39) V679M probably damaging Het
Itpr3 T A 17: 27,326,263 (GRCm39) H1344Q probably benign Het
Kcnma1 T C 14: 23,361,784 (GRCm39) M1074V possibly damaging Het
Kif1a G A 1: 92,983,967 (GRCm39) R602W probably damaging Het
Kif21b A T 1: 136,090,837 (GRCm39) D1215V probably benign Het
Mapk13 G A 17: 28,995,327 (GRCm39) V183M probably damaging Het
Mbp C T 18: 82,593,322 (GRCm39) S100F probably damaging Het
Mcm6 A G 1: 128,283,373 (GRCm39) I44T probably benign Het
Ncor1 T A 11: 62,264,148 (GRCm39) D418V possibly damaging Het
Nid2 T A 14: 19,839,736 (GRCm39) probably null Het
Nolc1 T C 19: 46,067,359 (GRCm39) V80A probably damaging Het
Or10a5 A T 7: 106,635,439 (GRCm39) T26S probably benign Het
Or10ak14 C A 4: 118,611,027 (GRCm39) C238F probably benign Het
Or12e9 A T 2: 87,201,896 (GRCm39) R7W probably damaging Het
Or13e8 A C 4: 43,697,079 (GRCm39) C31W probably damaging Het
Or1j1 A T 2: 36,702,492 (GRCm39) L204* probably null Het
Or2ag1 A T 7: 106,313,810 (GRCm39) M26K probably benign Het
Or2ag18 G A 7: 106,405,018 (GRCm39) S217F probably damaging Het
Or4a68 T C 2: 89,270,060 (GRCm39) T188A probably benign Het
Or4e1 T A 14: 52,701,383 (GRCm39) M1L possibly damaging Het
Or5d14 A T 2: 87,880,815 (GRCm39) I51N probably damaging Het
Or5m12 A G 2: 85,735,348 (GRCm39) F17L probably damaging Het
Or7g35 T A 9: 19,495,914 (GRCm39) I27N probably damaging Het
Pcgf3 T A 5: 108,622,978 (GRCm39) C38S probably damaging Het
Pdia4 A T 6: 47,777,936 (GRCm39) V352E probably damaging Het
Pik3c2a C A 7: 115,953,290 (GRCm39) V1202L probably damaging Het
Rbm15 G T 3: 107,239,846 (GRCm39) A184E possibly damaging Het
Rsph3a T A 17: 8,197,952 (GRCm39) L442* probably null Het
Scg2 G C 1: 79,413,320 (GRCm39) L468V probably damaging Het
Sdk1 A T 5: 141,923,473 (GRCm39) I365L probably benign Het
Setdb1 A G 3: 95,246,140 (GRCm39) V595A probably benign Het
Skic3 A C 13: 76,295,925 (GRCm39) M1063L probably benign Het
Slc22a22 T A 15: 57,113,046 (GRCm39) T398S probably benign Het
Stk11 C A 10: 79,962,119 (GRCm39) P217Q probably damaging Het
Tes G A 6: 17,097,557 (GRCm39) D222N probably benign Het
Tmem132e T A 11: 82,325,894 (GRCm39) I206N possibly damaging Het
Tmem214 G T 5: 31,029,876 (GRCm39) R251L probably damaging Het
Tmem253 T A 14: 52,256,036 (GRCm39) I105N probably damaging Het
Toe1 A G 4: 116,664,682 (GRCm39) V12A probably benign Het
Top1 C A 2: 160,556,079 (GRCm39) H513N probably damaging Het
Tph1 G T 7: 46,299,412 (GRCm39) Y376* probably null Het
Trim45 T A 3: 100,830,535 (GRCm39) L103Q probably damaging Het
Ttn T A 2: 76,774,518 (GRCm39) probably null Het
Twnk T C 19: 44,996,185 (GRCm39) V206A probably damaging Het
Ube2z A G 11: 95,941,114 (GRCm39) S343P probably damaging Het
Vmn2r8 T C 5: 108,951,049 (GRCm39) D132G probably benign Het
Wdr20rt A T 12: 65,272,581 (GRCm39) T15S probably benign Het
Wdr59 C T 8: 112,185,579 (GRCm39) R841Q possibly damaging Het
Wdtc1 A G 4: 133,036,151 (GRCm39) F130L possibly damaging Het
Wnk1 C T 6: 119,939,764 (GRCm39) R43Q probably damaging Het
Ythdf3 T C 3: 16,259,236 (GRCm39) L461P probably damaging Het
Zcchc2 T G 1: 105,943,821 (GRCm39) F462C possibly damaging Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165,379,483 (GRCm39) missense probably benign 0.45
IGL00731:Adcy10 APN 1 165,400,183 (GRCm39) missense probably benign
IGL01099:Adcy10 APN 1 165,367,411 (GRCm39) missense probably benign 0.21
IGL01464:Adcy10 APN 1 165,374,156 (GRCm39) missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165,340,737 (GRCm39) critical splice donor site probably null
IGL02002:Adcy10 APN 1 165,349,412 (GRCm39) missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165,398,189 (GRCm39) missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165,400,112 (GRCm39) missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165,386,697 (GRCm39) missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165,365,949 (GRCm39) missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165,337,977 (GRCm39) missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165,398,313 (GRCm39) missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165,395,295 (GRCm39) missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165,370,802 (GRCm39) missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165,347,087 (GRCm39) missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165,366,044 (GRCm39) nonsense probably null
Bugged UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
debye UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
malaysian UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
singaporean UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165,384,360 (GRCm39) missense probably benign 0.28
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165,400,160 (GRCm39) missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165,391,818 (GRCm39) missense probably benign 0.00
R0433:Adcy10 UTSW 1 165,379,591 (GRCm39) missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165,398,297 (GRCm39) missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165,347,088 (GRCm39) missense probably benign 0.04
R0533:Adcy10 UTSW 1 165,391,592 (GRCm39) missense probably benign 0.05
R0550:Adcy10 UTSW 1 165,392,884 (GRCm39) missense probably benign 0.00
R0554:Adcy10 UTSW 1 165,340,699 (GRCm39) missense probably benign
R0597:Adcy10 UTSW 1 165,352,631 (GRCm39) critical splice donor site probably null
R0629:Adcy10 UTSW 1 165,370,674 (GRCm39) missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165,391,516 (GRCm39) missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165,342,949 (GRCm39) missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165,345,972 (GRCm39) missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165,352,602 (GRCm39) missense probably benign 0.02
R1690:Adcy10 UTSW 1 165,347,494 (GRCm39) missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165,330,812 (GRCm39) missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165,349,530 (GRCm39) missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165,398,377 (GRCm39) missense probably benign 0.02
R1929:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165,352,591 (GRCm39) missense probably benign 0.02
R2211:Adcy10 UTSW 1 165,345,781 (GRCm39) missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165,386,166 (GRCm39) missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165,403,296 (GRCm39) missense probably benign 0.38
R4538:Adcy10 UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
R4644:Adcy10 UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
R4649:Adcy10 UTSW 1 165,331,618 (GRCm39) missense probably damaging 1.00
R4832:Adcy10 UTSW 1 165,334,213 (GRCm39) missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165,375,782 (GRCm39) missense probably benign
R4916:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165,391,532 (GRCm39) missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165,384,431 (GRCm39) missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165,347,069 (GRCm39) missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165,347,464 (GRCm39) missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165,340,709 (GRCm39) missense probably benign 0.43
R5692:Adcy10 UTSW 1 165,342,875 (GRCm39) missense probably benign 0.36
R5949:Adcy10 UTSW 1 165,367,386 (GRCm39) missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165,369,218 (GRCm39) missense probably benign 0.19
R6238:Adcy10 UTSW 1 165,403,297 (GRCm39) nonsense probably null
R6455:Adcy10 UTSW 1 165,345,943 (GRCm39) missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165,403,227 (GRCm39) missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165,334,204 (GRCm39) missense probably benign 0.21
R6957:Adcy10 UTSW 1 165,391,854 (GRCm39) missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165,384,485 (GRCm39) missense probably benign 0.02
R7027:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165,367,443 (GRCm39) missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165,366,091 (GRCm39) missense probably benign 0.27
R7130:Adcy10 UTSW 1 165,331,616 (GRCm39) missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165,337,939 (GRCm39) missense probably benign 0.01
R7182:Adcy10 UTSW 1 165,371,039 (GRCm39) splice site probably null
R7228:Adcy10 UTSW 1 165,337,841 (GRCm39) missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165,404,177 (GRCm39) missense unknown
R7561:Adcy10 UTSW 1 165,386,741 (GRCm39) missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165,398,340 (GRCm39) missense probably benign 0.01
R7812:Adcy10 UTSW 1 165,342,938 (GRCm39) missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165,340,737 (GRCm39) critical splice donor site probably null
R8040:Adcy10 UTSW 1 165,379,593 (GRCm39) missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165,374,118 (GRCm39) missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165,330,857 (GRCm39) missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165,337,906 (GRCm39) missense probably benign 0.34
R8812:Adcy10 UTSW 1 165,378,867 (GRCm39) missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165,345,914 (GRCm39) missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165,403,218 (GRCm39) missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165,370,679 (GRCm39) missense probably benign 0.00
R9712:Adcy10 UTSW 1 165,340,681 (GRCm39) missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165,379,678 (GRCm39) missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165,337,845 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGGGAAATAACCCAGAATGTGTTGTGC -3'
(R):5'- CTGGCAAATAGCTGACAGTCCACTC -3'

Sequencing Primer
(F):5'- TGTGCAAACCCATTGCTTG -3'
(R):5'- caatcaaaccaacaaacaaacaaac -3'
Posted On 2013-06-12