Incidental Mutation 'R5970:Cyld'
ID 470802
Institutional Source Beutler Lab
Gene Symbol Cyld
Ensembl Gene ENSMUSG00000036712
Gene Name CYLD lysine 63 deubiquitinase
Synonyms CYLD1, C130039D01Rik, 2900009M21Rik, 2010013M14Rik
MMRRC Submission 044153-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5970 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 89423656-89478573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 89459621 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 611 (A611S)
Ref Sequence ENSEMBL: ENSMUSP00000147654 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043526] [ENSMUST00000098519] [ENSMUST00000109626] [ENSMUST00000209206] [ENSMUST00000209532] [ENSMUST00000209559] [ENSMUST00000211554]
AlphaFold Q80TQ2
Predicted Effect probably benign
Transcript: ENSMUST00000043526
AA Change: A611S

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000039834
Gene: ENSMUSG00000036712
AA Change: A611S

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
low complexity region 397 411 N/A INTRINSIC
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 591 891 1.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098519
AA Change: A611S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000096119
Gene: ENSMUSG00000036712
AA Change: A611S

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 307 470 6.5e-88 PFAM
CAP_GLY 471 539 2.68e-20 SMART
Pfam:UCH 590 893 2.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109626
AA Change: A608S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105254
Gene: ENSMUSG00000036712
AA Change: A608S

DomainStartEndE-ValueType
low complexity region 109 120 N/A INTRINSIC
CAP_GLY 127 203 3.2e-18 SMART
CAP_GLY 232 303 5.37e-11 SMART
Pfam:CYLD_phos_site 304 467 2.5e-88 PFAM
CAP_GLY 468 536 2.68e-20 SMART
Pfam:UCH 587 890 2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209206
AA Change: A426S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably damaging
Transcript: ENSMUST00000209532
AA Change: A611S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000209559
AA Change: A608S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209722
Predicted Effect probably benign
Transcript: ENSMUST00000211554
AA Change: A608S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211038
Meta Mutation Damage Score 0.0585 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the ubiquitin C-terminal hydrolase subfamily of the deubiquitinating enzyme family. Members of this family catalyze the removal of ubiquitin from a substrate or another ubiquitin molecule and thereby play important roles in regulating signaling pathways, recycling ubiquitin and regulating protein stability. This protein removes ubiquitin from K-63-linked ubiquitin chains from proteins involved in NF-kappaB signaling and thus acts as a negative regulator of this pathway. In humans mutations in this gene have been associated with cylindromatosis, an autosomal dominant predisposition to tumors of skin appendages. In mouse deficiency of this gene impairs thymocyte development and increases susceptibility to skin and colon tumors. A pseudogene of this gene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Various knockout models with different exon deletions have been created. Observed phenotypes include altered T cell and B cell development, susceptibility to induced skin tumors, resistance to lethal lung infection, high colon tumor incidence, kinky tails, and neonatal death due to lung dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,574,028 (GRCm39) probably benign Het
Ambn T C 5: 88,615,810 (GRCm39) V413A possibly damaging Het
Amotl1 T A 9: 14,507,824 (GRCm39) D41V probably damaging Het
Arhgef26 T C 3: 62,247,468 (GRCm39) V184A probably benign Het
Birc6 G T 17: 74,925,497 (GRCm39) G936V possibly damaging Het
Ccser1 T A 6: 61,288,226 (GRCm39) S130T possibly damaging Het
Cecr2 A G 6: 120,697,868 (GRCm39) I56V probably damaging Het
Cfap52 A G 11: 67,821,570 (GRCm39) I486T probably damaging Het
Col4a3 A G 1: 82,694,050 (GRCm39) I1557V possibly damaging Het
Col6a5 T A 9: 105,823,046 (GRCm39) I104F unknown Het
Cry2 A G 2: 92,243,312 (GRCm39) S510P probably benign Het
Csmd2 G C 4: 128,439,944 (GRCm39) A3133P probably benign Het
Dennd4c G A 4: 86,743,749 (GRCm39) G1197E probably damaging Het
Dnah10 T C 5: 124,885,793 (GRCm39) F2969L probably benign Het
Dnai1 A G 4: 41,625,281 (GRCm39) K415R probably benign Het
Dnmbp T A 19: 43,842,610 (GRCm39) T1253S probably benign Het
Dsp T C 13: 38,379,678 (GRCm39) L1542P possibly damaging Het
Duox1 T A 2: 122,170,682 (GRCm39) L1234Q probably damaging Het
Efr3b T A 12: 4,018,590 (GRCm39) R585S possibly damaging Het
Gpt A G 15: 76,583,552 (GRCm39) probably null Het
Heatr6 G A 11: 83,644,544 (GRCm39) probably benign Het
Kcns2 A G 15: 34,839,930 (GRCm39) D431G probably benign Het
Kdm3b A G 18: 34,962,342 (GRCm39) N1543D probably damaging Het
Man2a1 A G 17: 64,932,375 (GRCm39) K154R probably benign Het
Mical3 G A 6: 120,935,232 (GRCm39) Q893* probably null Het
Morc3 C T 16: 93,663,341 (GRCm39) H515Y possibly damaging Het
Mprip A T 11: 59,648,547 (GRCm39) R750S probably damaging Het
Mroh1 G A 15: 76,335,691 (GRCm39) V1436M probably benign Het
Muc5ac C T 7: 141,344,406 (GRCm39) R69* probably null Het
Muc5b A T 7: 141,410,449 (GRCm39) Y1274F unknown Het
Mybpc1 A G 10: 88,378,318 (GRCm39) L674P probably damaging Het
Mypn A G 10: 62,966,802 (GRCm39) V958A probably benign Het
Nipbl T C 15: 8,326,302 (GRCm39) T2436A probably benign Het
Or7g20 A G 9: 18,946,443 (GRCm39) D8G probably benign Het
Pcdhb5 T A 18: 37,454,826 (GRCm39) L402Q probably damaging Het
Pigp T A 16: 94,171,053 (GRCm39) probably null Het
Rp1 A G 1: 4,418,685 (GRCm39) L809P probably benign Het
Scn3a T A 2: 65,325,125 (GRCm39) probably benign Het
Sdf2 A T 11: 78,136,906 (GRCm39) M29L probably benign Het
Serpina3b T G 12: 104,100,350 (GRCm39) L311V possibly damaging Het
Snx31 A T 15: 36,523,634 (GRCm39) Y349* probably null Het
Spidr A C 16: 15,932,733 (GRCm39) C182W probably damaging Het
St13 A T 15: 81,261,999 (GRCm39) S146R probably damaging Het
St8sia4 A G 1: 95,581,307 (GRCm39) V145A probably damaging Het
Stradb T C 1: 59,019,175 (GRCm39) probably null Het
Tcp11l2 T A 10: 84,430,661 (GRCm39) probably benign Het
Tfdp2 C T 9: 96,199,627 (GRCm39) P74S unknown Het
Tmprss15 C T 16: 78,854,547 (GRCm39) R287H probably benign Het
Trav10d T C 14: 53,048,779 (GRCm39) Y57H probably damaging Het
Vmn2r104 A G 17: 20,249,733 (GRCm39) I846T probably benign Het
Ywhah T A 5: 33,184,292 (GRCm39) M165K possibly damaging Het
Zfp324 C A 7: 12,703,293 (GRCm39) P72T probably benign Het
Other mutations in Cyld
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Cyld APN 8 89,432,085 (GRCm39) missense probably benign 0.41
IGL00481:Cyld APN 8 89,433,918 (GRCm39) missense probably damaging 1.00
IGL01013:Cyld APN 8 89,468,990 (GRCm39) missense probably damaging 1.00
IGL01653:Cyld APN 8 89,467,998 (GRCm39) missense probably damaging 1.00
IGL01700:Cyld APN 8 89,433,727 (GRCm39) missense probably damaging 0.99
IGL01845:Cyld APN 8 89,432,403 (GRCm39) nonsense probably null
IGL02366:Cyld APN 8 89,456,381 (GRCm39) missense probably damaging 1.00
IGL02379:Cyld APN 8 89,471,556 (GRCm39) nonsense probably null
IGL02506:Cyld APN 8 89,456,218 (GRCm39) missense possibly damaging 0.86
IGL02563:Cyld APN 8 89,462,522 (GRCm39) missense probably damaging 1.00
IGL02565:Cyld APN 8 89,467,919 (GRCm39) missense probably damaging 1.00
IGL02814:Cyld APN 8 89,471,525 (GRCm39) missense probably benign 0.29
PIT4131001:Cyld UTSW 8 89,473,543 (GRCm39) missense probably damaging 0.98
R0101:Cyld UTSW 8 89,444,928 (GRCm39) critical splice donor site probably null
R0122:Cyld UTSW 8 89,468,920 (GRCm39) missense probably damaging 1.00
R0529:Cyld UTSW 8 89,456,387 (GRCm39) missense probably benign 0.34
R0838:Cyld UTSW 8 89,467,978 (GRCm39) missense probably benign 0.15
R1589:Cyld UTSW 8 89,436,618 (GRCm39) missense possibly damaging 0.84
R1732:Cyld UTSW 8 89,458,295 (GRCm39) splice site probably benign
R2029:Cyld UTSW 8 89,471,940 (GRCm39) missense probably benign 0.09
R3701:Cyld UTSW 8 89,456,179 (GRCm39) missense probably benign
R3798:Cyld UTSW 8 89,461,558 (GRCm39) missense probably damaging 1.00
R4243:Cyld UTSW 8 89,457,383 (GRCm39) nonsense probably null
R4244:Cyld UTSW 8 89,457,383 (GRCm39) nonsense probably null
R4260:Cyld UTSW 8 89,468,019 (GRCm39) missense probably damaging 1.00
R4458:Cyld UTSW 8 89,445,929 (GRCm39) missense probably benign 0.24
R4551:Cyld UTSW 8 89,433,762 (GRCm39) missense possibly damaging 0.95
R4718:Cyld UTSW 8 89,468,933 (GRCm39) missense probably damaging 0.99
R4735:Cyld UTSW 8 89,456,278 (GRCm39) missense probably damaging 1.00
R4753:Cyld UTSW 8 89,471,444 (GRCm39) splice site probably null
R4966:Cyld UTSW 8 89,468,929 (GRCm39) missense possibly damaging 0.55
R4975:Cyld UTSW 8 89,433,860 (GRCm39) missense probably benign
R5375:Cyld UTSW 8 89,459,664 (GRCm39) missense possibly damaging 0.77
R5647:Cyld UTSW 8 89,461,554 (GRCm39) missense probably benign 0.10
R5741:Cyld UTSW 8 89,471,474 (GRCm39) missense probably damaging 1.00
R5837:Cyld UTSW 8 89,468,032 (GRCm39) missense probably damaging 0.99
R5931:Cyld UTSW 8 89,456,470 (GRCm39) splice site probably null
R5992:Cyld UTSW 8 89,459,681 (GRCm39) missense probably damaging 1.00
R6165:Cyld UTSW 8 89,473,561 (GRCm39) missense possibly damaging 0.88
R7135:Cyld UTSW 8 89,471,520 (GRCm39) missense possibly damaging 0.93
R7667:Cyld UTSW 8 89,468,930 (GRCm39) missense probably benign 0.01
R7858:Cyld UTSW 8 89,436,616 (GRCm39) missense probably damaging 0.98
R7912:Cyld UTSW 8 89,461,525 (GRCm39) missense probably damaging 1.00
R8076:Cyld UTSW 8 89,456,346 (GRCm39) missense probably benign 0.00
R8276:Cyld UTSW 8 89,461,556 (GRCm39) missense probably benign 0.06
R8282:Cyld UTSW 8 89,432,043 (GRCm39) missense probably benign 0.06
R8348:Cyld UTSW 8 89,456,197 (GRCm39) missense probably damaging 1.00
R8448:Cyld UTSW 8 89,456,197 (GRCm39) missense probably damaging 1.00
R8540:Cyld UTSW 8 89,473,568 (GRCm39) missense probably damaging 1.00
R8676:Cyld UTSW 8 89,456,138 (GRCm39) missense probably benign 0.02
R8710:Cyld UTSW 8 89,436,523 (GRCm39) missense probably damaging 1.00
R8957:Cyld UTSW 8 89,432,410 (GRCm39) missense probably damaging 0.97
R9329:Cyld UTSW 8 89,457,348 (GRCm39) missense probably benign 0.22
RF016:Cyld UTSW 8 89,432,069 (GRCm39) nonsense probably null
X0010:Cyld UTSW 8 89,473,540 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACACTAATGGCTGAACACAG -3'
(R):5'- ACCTCATCTGCTTTTAGTACAGTG -3'

Sequencing Primer
(F):5'- TGAACACAGGCCTCTGCTGTC -3'
(R):5'- CACTGAAATAAACAGAAGCAGAAGAC -3'
Posted On 2017-03-31