Mutagenetix > Incidental Mutations

Incidental Mutation 'R5970:Amotl1'

470803

Institutional Source

Beutler Lab

Gene Symbol

Amotl1

Ensembl Gene

ENSMUSG00000013076

Gene Name

angiomotin-like 1

Synonyms

JEAP, 2310067L22Rik, 2310010G08Rik, 4932416D09Rik

MMRRC Submission

044153-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.119) question?

Stock #

R5970 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

14541966-14645056 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 14596528 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 41 (D41V)

Ref Sequence

ENSEMBL: ENSMUSP00000013220 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000013220] [ENSMUST00000162901] [ENSMUST00000223132]

Predicted Effect

probably damaging
Transcript: ENSMUST00000013220
AA Change: D41V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000013220
Gene: ENSMUSG00000013076
AA Change: D41V

Domain	Start	End	E-Value	Type
low complexity region	203	224	N/A	INTRINSIC
low complexity region	418	441	N/A	INTRINSIC
coiled coil region	449	472	N/A	INTRINSIC
Blast:PAC	491	532	1e-10	BLAST
low complexity region	562	575	N/A	INTRINSIC
Pfam:Angiomotin_C	616	822	4.4e-96	PFAM
low complexity region	853	878	N/A	INTRINSIC
low complexity region	881	895	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160770

SMART Domains

Protein: ENSMUSP00000124281
Gene: ENSMUSG00000013076

Domain	Start	End	E-Value	Type
low complexity region	117	138	N/A	INTRINSIC
low complexity region	332	355	N/A	INTRINSIC
coiled coil region	363	386	N/A	INTRINSIC
Blast:PAC	405	446	1e-10	BLAST
low complexity region	476	489	N/A	INTRINSIC
Pfam:Angiomotin_C	530	738	5.2e-95	PFAM
low complexity region	767	792	N/A	INTRINSIC
low complexity region	795	809	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162802

Predicted Effect

probably benign
Transcript: ENSMUST00000162901

Predicted Effect

probably benign
Transcript: ENSMUST00000162901

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223132
AA Change: D78V

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)

Meta Mutation Damage Score

0.2788

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein that is a component of tight junctions or TJs. TJs form an apical junctional structure and act to control paracellular permeability and maintain cell polarity. This protein is related to angiomotin, an angiostatin binding protein that regulates endothelial cell migration and capillary formation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1l1	G	A	6: 90,597,046		probably benign	Het
Ambn	T	C	5: 88,467,951	V413A	possibly damaging	Het
Arhgef26	T	C	3: 62,340,047	V184A	probably benign	Het
Birc6	G	T	17: 74,618,502	G936V	possibly damaging	Het
Ccser1	T	A	6: 61,311,242	S130T	possibly damaging	Het
Cecr2	A	G	6: 120,720,907	I56V	probably damaging	Het
Cfap52	A	G	11: 67,930,744	I486T	probably damaging	Het
Col4a3	A	G	1: 82,716,329	I1557V	possibly damaging	Het
Col6a5	T	A	9: 105,945,847	I104F	unknown	Het
Cry2	A	G	2: 92,412,967	S510P	probably benign	Het
Csmd2	G	C	4: 128,546,151	A3133P	probably benign	Het
Cyld	G	T	8: 88,732,993	A611S	probably damaging	Het
Dennd4c	G	A	4: 86,825,512	G1197E	probably damaging	Het
Dnah10	T	C	5: 124,808,729	F2969L	probably benign	Het
Dnaic1	A	G	4: 41,625,281	K415R	probably benign	Het
Dnmbp	T	A	19: 43,854,171	T1253S	probably benign	Het
Dsp	T	C	13: 38,195,702	L1542P	possibly damaging	Het
Duox1	T	A	2: 122,340,201	L1234Q	probably damaging	Het
Efr3b	T	A	12: 3,968,590	R585S	possibly damaging	Het
Gpt	A	G	15: 76,699,352		probably null	Het
Heatr6	G	A	11: 83,753,718		probably benign	Het
Kcns2	A	G	15: 34,839,784	D431G	probably benign	Het
Kdm3b	A	G	18: 34,829,289	N1543D	probably damaging	Het
Man2a1	A	G	17: 64,625,380	K154R	probably benign	Het
Mical3	G	A	6: 120,958,271	Q893*	probably null	Het
Morc3	C	T	16: 93,866,453	H515Y	possibly damaging	Het
Mprip	A	T	11: 59,757,721	R750S	probably damaging	Het
Mroh1	G	A	15: 76,451,491	V1436M	probably benign	Het
Muc5ac	C	T	7: 141,790,669	R69*	probably null	Het
Muc5b	A	T	7: 141,856,712	Y1274F	unknown	Het
Mybpc1	A	G	10: 88,542,456	L674P	probably damaging	Het
Mypn	A	G	10: 63,131,023	V958A	probably benign	Het
Nipbl	T	C	15: 8,296,818	T2436A	probably benign	Het
Olfr835	A	G	9: 19,035,147	D8G	probably benign	Het
Pcdhb5	T	A	18: 37,321,773	L402Q	probably damaging	Het
Pigp	T	A	16: 94,370,194		probably null	Het
Rp1	A	G	1: 4,348,462	L809P	probably benign	Het
Scn3a	T	A	2: 65,494,781		probably benign	Het
Sdf2	A	T	11: 78,246,080	M29L	probably benign	Het
Serpina3b	T	G	12: 104,134,091	L311V	possibly damaging	Het
Snx31	A	T	15: 36,523,488	Y349*	probably null	Het
Spidr	A	C	16: 16,114,869	C182W	probably damaging	Het
St13	A	T	15: 81,377,798	S146R	probably damaging	Het
St8sia4	A	G	1: 95,653,582	V145A	probably damaging	Het
Stradb	T	C	1: 58,980,016		probably null	Het
Tcp11l2	T	A	10: 84,594,797		probably benign	Het
Tfdp2	C	T	9: 96,317,574	P74S	unknown	Het
Tmprss15	C	T	16: 79,057,659	R287H	probably benign	Het
Trav10d	T	C	14: 52,811,322	Y57H	probably damaging	Het
Vmn2r104	A	G	17: 20,029,471	I846T	probably benign	Het
Ywhah	T	A	5: 33,026,948	M165K	possibly damaging	Het
Zfp324	C	A	7: 12,969,366	P72T	probably benign	Het

Other mutations in Amotl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02157:Amotl1	APN	9	14571715	splice site	probably benign
IGL02750:Amotl1	APN	9	14548791	missense	probably benign	0.34
R0071:Amotl1	UTSW	9	14548773	missense	probably benign	0.25
R0071:Amotl1	UTSW	9	14548773	missense	probably benign	0.25
R0094:Amotl1	UTSW	9	14575387	missense	probably benign	0.12
R0094:Amotl1	UTSW	9	14575387	missense	probably benign	0.12
R0178:Amotl1	UTSW	9	14548773	missense	probably benign	0.25
R0179:Amotl1	UTSW	9	14548773	missense	probably benign	0.25
R0853:Amotl1	UTSW	9	14592778	missense	probably damaging	0.99
R0941:Amotl1	UTSW	9	14596558	missense	possibly damaging	0.90
R1447:Amotl1	UTSW	9	14555742	missense	probably benign
R1689:Amotl1	UTSW	9	14593222	missense	probably damaging	0.99
R1692:Amotl1	UTSW	9	14551722	missense	possibly damaging	0.94
R1858:Amotl1	UTSW	9	14575401	missense	probably benign	0.34
R2158:Amotl1	UTSW	9	14575169	missense	probably benign	0.00
R2184:Amotl1	UTSW	9	14575390	missense	probably benign	0.00
R3040:Amotl1	UTSW	9	14572773	missense	probably benign	0.42
R4226:Amotl1	UTSW	9	14593678	missense	probably benign	0.00
R4776:Amotl1	UTSW	9	14593373	nonsense	probably null
R4854:Amotl1	UTSW	9	14593451	nonsense	probably null
R5283:Amotl1	UTSW	9	14558484	missense	probably damaging	1.00
R5478:Amotl1	UTSW	9	14592752	critical splice donor site	probably null
R5562:Amotl1	UTSW	9	14575297	missense	possibly damaging	0.56
R6265:Amotl1	UTSW	9	14571655	missense	possibly damaging	0.93
R6974:Amotl1	UTSW	9	14644920	nonsense	probably null
R7016:Amotl1	UTSW	9	14593699	missense	probably damaging	0.99
R7058:Amotl1	UTSW	9	14575236	missense	possibly damaging	0.94
R7317:Amotl1	UTSW	9	14575219	missense	probably benign	0.02
R7730:Amotl1	UTSW	9	14555763	missense	possibly damaging	0.53
R7994:Amotl1	UTSW	9	14593361	missense	probably damaging	0.98
R7996:Amotl1	UTSW	9	14593705	missense	possibly damaging	0.94
R8077:Amotl1	UTSW	9	14550502	missense	probably damaging	1.00
R8116:Amotl1	UTSW	9	14555572	critical splice donor site	probably null
R8140:Amotl1	UTSW	9	14572715	splice site	probably null
R8362:Amotl1	UTSW	9	14644922	missense	probably benign	0.26
R8364:Amotl1	UTSW	9	14644922	missense	probably benign	0.26
R8526:Amotl1	UTSW	9	14562196	missense	probably damaging	1.00
R8855:Amotl1	UTSW	9	14555573	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTAAAGTCACAGGCACGGG -3'
(R):5'- AAGCTTGTGGGTCAGCATG -3'

Sequencing Primer
(F):5'- TCACAGGCACGGGGATTACTTAATG -3'
(R):5'- GTGACAGTTCTGGGAAGTAGC -3'

Posted On

2017-03-31