Incidental Mutation 'R5970:Amotl1'
ID 470803
Institutional Source Beutler Lab
Gene Symbol Amotl1
Ensembl Gene ENSMUSG00000013076
Gene Name angiomotin-like 1
Synonyms 2310067L22Rik, JEAP, 2310010G08Rik, 4932416D09Rik
MMRRC Submission 044153-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R5970 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 14453262-14556352 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 14507824 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 41 (D41V)
Ref Sequence ENSEMBL: ENSMUSP00000013220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013220] [ENSMUST00000162901] [ENSMUST00000223132]
AlphaFold Q9D4H4
Predicted Effect probably damaging
Transcript: ENSMUST00000013220
AA Change: D41V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000013220
Gene: ENSMUSG00000013076
AA Change: D41V

DomainStartEndE-ValueType
low complexity region 203 224 N/A INTRINSIC
low complexity region 418 441 N/A INTRINSIC
coiled coil region 449 472 N/A INTRINSIC
Blast:PAC 491 532 1e-10 BLAST
low complexity region 562 575 N/A INTRINSIC
Pfam:Angiomotin_C 616 822 4.4e-96 PFAM
low complexity region 853 878 N/A INTRINSIC
low complexity region 881 895 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160770
SMART Domains Protein: ENSMUSP00000124281
Gene: ENSMUSG00000013076

DomainStartEndE-ValueType
low complexity region 117 138 N/A INTRINSIC
low complexity region 332 355 N/A INTRINSIC
coiled coil region 363 386 N/A INTRINSIC
Blast:PAC 405 446 1e-10 BLAST
low complexity region 476 489 N/A INTRINSIC
Pfam:Angiomotin_C 530 738 5.2e-95 PFAM
low complexity region 767 792 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162802
Predicted Effect probably benign
Transcript: ENSMUST00000162901
Predicted Effect probably benign
Transcript: ENSMUST00000162901
Predicted Effect possibly damaging
Transcript: ENSMUST00000223132
AA Change: D78V

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.2788 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein that is a component of tight junctions or TJs. TJs form an apical junctional structure and act to control paracellular permeability and maintain cell polarity. This protein is related to angiomotin, an angiostatin binding protein that regulates endothelial cell migration and capillary formation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,574,028 (GRCm39) probably benign Het
Ambn T C 5: 88,615,810 (GRCm39) V413A possibly damaging Het
Arhgef26 T C 3: 62,247,468 (GRCm39) V184A probably benign Het
Birc6 G T 17: 74,925,497 (GRCm39) G936V possibly damaging Het
Ccser1 T A 6: 61,288,226 (GRCm39) S130T possibly damaging Het
Cecr2 A G 6: 120,697,868 (GRCm39) I56V probably damaging Het
Cfap52 A G 11: 67,821,570 (GRCm39) I486T probably damaging Het
Col4a3 A G 1: 82,694,050 (GRCm39) I1557V possibly damaging Het
Col6a5 T A 9: 105,823,046 (GRCm39) I104F unknown Het
Cry2 A G 2: 92,243,312 (GRCm39) S510P probably benign Het
Csmd2 G C 4: 128,439,944 (GRCm39) A3133P probably benign Het
Cyld G T 8: 89,459,621 (GRCm39) A611S probably damaging Het
Dennd4c G A 4: 86,743,749 (GRCm39) G1197E probably damaging Het
Dnah10 T C 5: 124,885,793 (GRCm39) F2969L probably benign Het
Dnai1 A G 4: 41,625,281 (GRCm39) K415R probably benign Het
Dnmbp T A 19: 43,842,610 (GRCm39) T1253S probably benign Het
Dsp T C 13: 38,379,678 (GRCm39) L1542P possibly damaging Het
Duox1 T A 2: 122,170,682 (GRCm39) L1234Q probably damaging Het
Efr3b T A 12: 4,018,590 (GRCm39) R585S possibly damaging Het
Gpt A G 15: 76,583,552 (GRCm39) probably null Het
Heatr6 G A 11: 83,644,544 (GRCm39) probably benign Het
Kcns2 A G 15: 34,839,930 (GRCm39) D431G probably benign Het
Kdm3b A G 18: 34,962,342 (GRCm39) N1543D probably damaging Het
Man2a1 A G 17: 64,932,375 (GRCm39) K154R probably benign Het
Mical3 G A 6: 120,935,232 (GRCm39) Q893* probably null Het
Morc3 C T 16: 93,663,341 (GRCm39) H515Y possibly damaging Het
Mprip A T 11: 59,648,547 (GRCm39) R750S probably damaging Het
Mroh1 G A 15: 76,335,691 (GRCm39) V1436M probably benign Het
Muc5ac C T 7: 141,344,406 (GRCm39) R69* probably null Het
Muc5b A T 7: 141,410,449 (GRCm39) Y1274F unknown Het
Mybpc1 A G 10: 88,378,318 (GRCm39) L674P probably damaging Het
Mypn A G 10: 62,966,802 (GRCm39) V958A probably benign Het
Nipbl T C 15: 8,326,302 (GRCm39) T2436A probably benign Het
Or7g20 A G 9: 18,946,443 (GRCm39) D8G probably benign Het
Pcdhb5 T A 18: 37,454,826 (GRCm39) L402Q probably damaging Het
Pigp T A 16: 94,171,053 (GRCm39) probably null Het
Rp1 A G 1: 4,418,685 (GRCm39) L809P probably benign Het
Scn3a T A 2: 65,325,125 (GRCm39) probably benign Het
Sdf2 A T 11: 78,136,906 (GRCm39) M29L probably benign Het
Serpina3b T G 12: 104,100,350 (GRCm39) L311V possibly damaging Het
Snx31 A T 15: 36,523,634 (GRCm39) Y349* probably null Het
Spidr A C 16: 15,932,733 (GRCm39) C182W probably damaging Het
St13 A T 15: 81,261,999 (GRCm39) S146R probably damaging Het
St8sia4 A G 1: 95,581,307 (GRCm39) V145A probably damaging Het
Stradb T C 1: 59,019,175 (GRCm39) probably null Het
Tcp11l2 T A 10: 84,430,661 (GRCm39) probably benign Het
Tfdp2 C T 9: 96,199,627 (GRCm39) P74S unknown Het
Tmprss15 C T 16: 78,854,547 (GRCm39) R287H probably benign Het
Trav10d T C 14: 53,048,779 (GRCm39) Y57H probably damaging Het
Vmn2r104 A G 17: 20,249,733 (GRCm39) I846T probably benign Het
Ywhah T A 5: 33,184,292 (GRCm39) M165K possibly damaging Het
Zfp324 C A 7: 12,703,293 (GRCm39) P72T probably benign Het
Other mutations in Amotl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Amotl1 APN 9 14,483,011 (GRCm39) splice site probably benign
IGL02750:Amotl1 APN 9 14,460,087 (GRCm39) missense probably benign 0.34
R0071:Amotl1 UTSW 9 14,460,069 (GRCm39) missense probably benign 0.25
R0071:Amotl1 UTSW 9 14,460,069 (GRCm39) missense probably benign 0.25
R0094:Amotl1 UTSW 9 14,486,683 (GRCm39) missense probably benign 0.12
R0094:Amotl1 UTSW 9 14,486,683 (GRCm39) missense probably benign 0.12
R0178:Amotl1 UTSW 9 14,460,069 (GRCm39) missense probably benign 0.25
R0179:Amotl1 UTSW 9 14,460,069 (GRCm39) missense probably benign 0.25
R0853:Amotl1 UTSW 9 14,504,074 (GRCm39) missense probably damaging 0.99
R0941:Amotl1 UTSW 9 14,507,854 (GRCm39) missense possibly damaging 0.90
R1447:Amotl1 UTSW 9 14,467,038 (GRCm39) missense probably benign
R1689:Amotl1 UTSW 9 14,504,518 (GRCm39) missense probably damaging 0.99
R1692:Amotl1 UTSW 9 14,463,018 (GRCm39) missense possibly damaging 0.94
R1858:Amotl1 UTSW 9 14,486,697 (GRCm39) missense probably benign 0.34
R2158:Amotl1 UTSW 9 14,486,465 (GRCm39) missense probably benign 0.00
R2184:Amotl1 UTSW 9 14,486,686 (GRCm39) missense probably benign 0.00
R3040:Amotl1 UTSW 9 14,484,069 (GRCm39) missense probably benign 0.42
R4226:Amotl1 UTSW 9 14,504,974 (GRCm39) missense probably benign 0.00
R4776:Amotl1 UTSW 9 14,504,669 (GRCm39) nonsense probably null
R4854:Amotl1 UTSW 9 14,504,747 (GRCm39) nonsense probably null
R5283:Amotl1 UTSW 9 14,469,780 (GRCm39) missense probably damaging 1.00
R5478:Amotl1 UTSW 9 14,504,048 (GRCm39) critical splice donor site probably null
R5562:Amotl1 UTSW 9 14,486,593 (GRCm39) missense possibly damaging 0.56
R6265:Amotl1 UTSW 9 14,482,951 (GRCm39) missense possibly damaging 0.93
R6974:Amotl1 UTSW 9 14,556,216 (GRCm39) nonsense probably null
R7016:Amotl1 UTSW 9 14,504,995 (GRCm39) missense probably damaging 0.99
R7058:Amotl1 UTSW 9 14,486,532 (GRCm39) missense possibly damaging 0.94
R7317:Amotl1 UTSW 9 14,486,515 (GRCm39) missense probably benign 0.02
R7730:Amotl1 UTSW 9 14,467,059 (GRCm39) missense possibly damaging 0.53
R7994:Amotl1 UTSW 9 14,504,657 (GRCm39) missense probably damaging 0.98
R7996:Amotl1 UTSW 9 14,505,001 (GRCm39) missense possibly damaging 0.94
R8077:Amotl1 UTSW 9 14,461,798 (GRCm39) missense probably damaging 1.00
R8116:Amotl1 UTSW 9 14,466,868 (GRCm39) critical splice donor site probably null
R8140:Amotl1 UTSW 9 14,484,011 (GRCm39) splice site probably null
R8362:Amotl1 UTSW 9 14,556,218 (GRCm39) missense probably benign 0.26
R8364:Amotl1 UTSW 9 14,556,218 (GRCm39) missense probably benign 0.26
R8526:Amotl1 UTSW 9 14,473,492 (GRCm39) missense probably damaging 1.00
R8855:Amotl1 UTSW 9 14,466,869 (GRCm39) critical splice donor site probably null
R8904:Amotl1 UTSW 9 14,469,861 (GRCm39) missense probably damaging 1.00
R9179:Amotl1 UTSW 9 14,461,787 (GRCm39) missense possibly damaging 0.89
R9228:Amotl1 UTSW 9 14,504,320 (GRCm39) missense possibly damaging 0.69
R9361:Amotl1 UTSW 9 14,504,677 (GRCm39) missense probably benign 0.03
R9513:Amotl1 UTSW 9 14,526,063 (GRCm39) missense probably benign
R9563:Amotl1 UTSW 9 14,473,513 (GRCm39) missense possibly damaging 0.95
R9564:Amotl1 UTSW 9 14,473,513 (GRCm39) missense possibly damaging 0.95
R9620:Amotl1 UTSW 9 14,459,969 (GRCm39) missense probably damaging 1.00
R9654:Amotl1 UTSW 9 14,462,981 (GRCm39) missense probably benign 0.19
R9750:Amotl1 UTSW 9 14,504,102 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTAAAGTCACAGGCACGGG -3'
(R):5'- AAGCTTGTGGGTCAGCATG -3'

Sequencing Primer
(F):5'- TCACAGGCACGGGGATTACTTAATG -3'
(R):5'- GTGACAGTTCTGGGAAGTAGC -3'
Posted On 2017-03-31