Incidental Mutation 'R5970:Amotl1'
ID470803
Institutional Source Beutler Lab
Gene Symbol Amotl1
Ensembl Gene ENSMUSG00000013076
Gene Nameangiomotin-like 1
SynonymsJEAP, 2310067L22Rik, 2310010G08Rik, 4932416D09Rik
MMRRC Submission 044153-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5970 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location14541966-14645056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14596528 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 41 (D41V)
Ref Sequence ENSEMBL: ENSMUSP00000013220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013220] [ENSMUST00000162901] [ENSMUST00000223132]
Predicted Effect probably damaging
Transcript: ENSMUST00000013220
AA Change: D41V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000013220
Gene: ENSMUSG00000013076
AA Change: D41V

DomainStartEndE-ValueType
low complexity region 203 224 N/A INTRINSIC
low complexity region 418 441 N/A INTRINSIC
coiled coil region 449 472 N/A INTRINSIC
Blast:PAC 491 532 1e-10 BLAST
low complexity region 562 575 N/A INTRINSIC
Pfam:Angiomotin_C 616 822 4.4e-96 PFAM
low complexity region 853 878 N/A INTRINSIC
low complexity region 881 895 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160770
SMART Domains Protein: ENSMUSP00000124281
Gene: ENSMUSG00000013076

DomainStartEndE-ValueType
low complexity region 117 138 N/A INTRINSIC
low complexity region 332 355 N/A INTRINSIC
coiled coil region 363 386 N/A INTRINSIC
Blast:PAC 405 446 1e-10 BLAST
low complexity region 476 489 N/A INTRINSIC
Pfam:Angiomotin_C 530 738 5.2e-95 PFAM
low complexity region 767 792 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162802
Predicted Effect probably benign
Transcript: ENSMUST00000162901
Predicted Effect probably benign
Transcript: ENSMUST00000162901
Predicted Effect possibly damaging
Transcript: ENSMUST00000223132
AA Change: D78V

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.2788 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein that is a component of tight junctions or TJs. TJs form an apical junctional structure and act to control paracellular permeability and maintain cell polarity. This protein is related to angiomotin, an angiostatin binding protein that regulates endothelial cell migration and capillary formation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,597,046 probably benign Het
Ambn T C 5: 88,467,951 V413A possibly damaging Het
Arhgef26 T C 3: 62,340,047 V184A probably benign Het
Birc6 G T 17: 74,618,502 G936V possibly damaging Het
Ccser1 T A 6: 61,311,242 S130T possibly damaging Het
Cecr2 A G 6: 120,720,907 I56V probably damaging Het
Cfap52 A G 11: 67,930,744 I486T probably damaging Het
Col4a3 A G 1: 82,716,329 I1557V possibly damaging Het
Col6a5 T A 9: 105,945,847 I104F unknown Het
Cry2 A G 2: 92,412,967 S510P probably benign Het
Csmd2 G C 4: 128,546,151 A3133P probably benign Het
Cyld G T 8: 88,732,993 A611S probably damaging Het
Dennd4c G A 4: 86,825,512 G1197E probably damaging Het
Dnah10 T C 5: 124,808,729 F2969L probably benign Het
Dnaic1 A G 4: 41,625,281 K415R probably benign Het
Dnmbp T A 19: 43,854,171 T1253S probably benign Het
Dsp T C 13: 38,195,702 L1542P possibly damaging Het
Duox1 T A 2: 122,340,201 L1234Q probably damaging Het
Efr3b T A 12: 3,968,590 R585S possibly damaging Het
Gpt A G 15: 76,699,352 probably null Het
Heatr6 G A 11: 83,753,718 probably benign Het
Kcns2 A G 15: 34,839,784 D431G probably benign Het
Kdm3b A G 18: 34,829,289 N1543D probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mical3 G A 6: 120,958,271 Q893* probably null Het
Morc3 C T 16: 93,866,453 H515Y possibly damaging Het
Mprip A T 11: 59,757,721 R750S probably damaging Het
Mroh1 G A 15: 76,451,491 V1436M probably benign Het
Muc5ac C T 7: 141,790,669 R69* probably null Het
Muc5b A T 7: 141,856,712 Y1274F unknown Het
Mybpc1 A G 10: 88,542,456 L674P probably damaging Het
Mypn A G 10: 63,131,023 V958A probably benign Het
Nipbl T C 15: 8,296,818 T2436A probably benign Het
Olfr835 A G 9: 19,035,147 D8G probably benign Het
Pcdhb5 T A 18: 37,321,773 L402Q probably damaging Het
Pigp T A 16: 94,370,194 probably null Het
Rp1 A G 1: 4,348,462 L809P probably benign Het
Scn3a T A 2: 65,494,781 probably benign Het
Sdf2 A T 11: 78,246,080 M29L probably benign Het
Serpina3b T G 12: 104,134,091 L311V possibly damaging Het
Snx31 A T 15: 36,523,488 Y349* probably null Het
Spidr A C 16: 16,114,869 C182W probably damaging Het
St13 A T 15: 81,377,798 S146R probably damaging Het
St8sia4 A G 1: 95,653,582 V145A probably damaging Het
Stradb T C 1: 58,980,016 probably null Het
Tcp11l2 T A 10: 84,594,797 probably benign Het
Tfdp2 C T 9: 96,317,574 P74S unknown Het
Tmprss15 C T 16: 79,057,659 R287H probably benign Het
Trav10d T C 14: 52,811,322 Y57H probably damaging Het
Vmn2r104 A G 17: 20,029,471 I846T probably benign Het
Ywhah T A 5: 33,026,948 M165K possibly damaging Het
Zfp324 C A 7: 12,969,366 P72T probably benign Het
Other mutations in Amotl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02157:Amotl1 APN 9 14571715 splice site probably benign
IGL02750:Amotl1 APN 9 14548791 missense probably benign 0.34
R0071:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0071:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0094:Amotl1 UTSW 9 14575387 missense probably benign 0.12
R0094:Amotl1 UTSW 9 14575387 missense probably benign 0.12
R0178:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0179:Amotl1 UTSW 9 14548773 missense probably benign 0.25
R0853:Amotl1 UTSW 9 14592778 missense probably damaging 0.99
R0941:Amotl1 UTSW 9 14596558 missense possibly damaging 0.90
R1447:Amotl1 UTSW 9 14555742 missense probably benign
R1689:Amotl1 UTSW 9 14593222 missense probably damaging 0.99
R1692:Amotl1 UTSW 9 14551722 missense possibly damaging 0.94
R1858:Amotl1 UTSW 9 14575401 missense probably benign 0.34
R2158:Amotl1 UTSW 9 14575169 missense probably benign 0.00
R2184:Amotl1 UTSW 9 14575390 missense probably benign 0.00
R3040:Amotl1 UTSW 9 14572773 missense probably benign 0.42
R4226:Amotl1 UTSW 9 14593678 missense probably benign 0.00
R4776:Amotl1 UTSW 9 14593373 nonsense probably null
R4854:Amotl1 UTSW 9 14593451 nonsense probably null
R5283:Amotl1 UTSW 9 14558484 missense probably damaging 1.00
R5478:Amotl1 UTSW 9 14592752 critical splice donor site probably null
R5562:Amotl1 UTSW 9 14575297 missense possibly damaging 0.56
R6265:Amotl1 UTSW 9 14571655 missense possibly damaging 0.93
R6974:Amotl1 UTSW 9 14644920 nonsense probably null
R7016:Amotl1 UTSW 9 14593699 missense probably damaging 0.99
R7058:Amotl1 UTSW 9 14575236 missense possibly damaging 0.94
R7317:Amotl1 UTSW 9 14575219 missense probably benign 0.02
R7730:Amotl1 UTSW 9 14555763 missense possibly damaging 0.53
R7994:Amotl1 UTSW 9 14593361 missense probably damaging 0.98
R7996:Amotl1 UTSW 9 14593705 missense possibly damaging 0.94
R8077:Amotl1 UTSW 9 14550502 missense probably damaging 1.00
R8116:Amotl1 UTSW 9 14555572 critical splice donor site probably null
R8140:Amotl1 UTSW 9 14572715 splice site probably null
R8362:Amotl1 UTSW 9 14644922 missense probably benign 0.26
R8364:Amotl1 UTSW 9 14644922 missense probably benign 0.26
R8526:Amotl1 UTSW 9 14562196 missense probably damaging 1.00
R8855:Amotl1 UTSW 9 14555573 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTAAAGTCACAGGCACGGG -3'
(R):5'- AAGCTTGTGGGTCAGCATG -3'

Sequencing Primer
(F):5'- TCACAGGCACGGGGATTACTTAATG -3'
(R):5'- GTGACAGTTCTGGGAAGTAGC -3'
Posted On2017-03-31