Incidental Mutation 'R5970:Tfdp2'
ID470805
Institutional Source Beutler Lab
Gene Symbol Tfdp2
Ensembl Gene ENSMUSG00000032411
Gene Nametranscription factor Dp 2
SynonymsA330080J22Rik, DP3, DP3, 1110029I05Rik, DP-3
MMRRC Submission 044153-MU
Accession Numbers

Genbank: NM_001184706.1, NM_001184708.1, NM_001184709.1, NM_001184710.1, NM_001184711.1, NM_178667.4

Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R5970 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location96196275-96323646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 96317574 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 74 (P74S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034982] [ENSMUST00000165120] [ENSMUST00000165768] [ENSMUST00000179065] [ENSMUST00000179416] [ENSMUST00000185644] [ENSMUST00000188008] [ENSMUST00000188750] [ENSMUST00000189606]
Predicted Effect silent
Transcript: ENSMUST00000034982
SMART Domains Protein: ENSMUSP00000034982
Gene: ENSMUSG00000032411

DomainStartEndE-ValueType
Pfam:E2F_TDP 66 147 3.8e-29 PFAM
DP 154 298 1.69e-87 SMART
low complexity region 345 361 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000165120
SMART Domains Protein: ENSMUSP00000132934
Gene: ENSMUSG00000032411

DomainStartEndE-ValueType
Pfam:E2F_TDP 1 72 3.2e-25 PFAM
DP 79 223 1.69e-87 SMART
low complexity region 270 286 N/A INTRINSIC
low complexity region 296 310 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000165768
SMART Domains Protein: ENSMUSP00000128260
Gene: ENSMUSG00000032411

DomainStartEndE-ValueType
E2F_TDP 66 148 1.39e-33 SMART
DP 155 299 1.69e-87 SMART
low complexity region 346 362 N/A INTRINSIC
low complexity region 372 386 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000179065
SMART Domains Protein: ENSMUSP00000136817
Gene: ENSMUSG00000032411

DomainStartEndE-ValueType
Pfam:E2F_TDP 40 121 3.9e-29 PFAM
DP 128 272 1.69e-87 SMART
low complexity region 319 335 N/A INTRINSIC
low complexity region 345 359 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000179416
SMART Domains Protein: ENSMUSP00000137176
Gene: ENSMUSG00000032411

DomainStartEndE-ValueType
Pfam:E2F_TDP 66 147 3.8e-29 PFAM
DP 154 298 1.69e-87 SMART
low complexity region 345 361 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000185644
SMART Domains Protein: ENSMUSP00000140061
Gene: ENSMUSG00000032411

DomainStartEndE-ValueType
Pfam:E2F_TDP 66 147 3.8e-29 PFAM
DP 154 298 1.69e-87 SMART
low complexity region 345 361 N/A INTRINSIC
low complexity region 371 385 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000188008
SMART Domains Protein: ENSMUSP00000139848
Gene: ENSMUSG00000032411

DomainStartEndE-ValueType
Pfam:E2F_TDP 50 132 1e-26 PFAM
DP 139 283 8e-92 SMART
low complexity region 330 346 N/A INTRINSIC
low complexity region 356 365 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000188750
SMART Domains Protein: ENSMUSP00000139926
Gene: ENSMUSG00000032411

DomainStartEndE-ValueType
Pfam:E2F_TDP 127 208 1.3e-26 PFAM
DP 215 359 8e-92 SMART
low complexity region 406 422 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000189606
SMART Domains Protein: ENSMUSP00000141084
Gene: ENSMUSG00000032411

DomainStartEndE-ValueType
Pfam:E2F_TDP 50 132 1e-26 PFAM
DP 139 283 8e-92 SMART
low complexity region 330 346 N/A INTRINSIC
low complexity region 356 365 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000191133
AA Change: P74S
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the transcription factor DP family. The encoded protein forms heterodimers with the E2F transcription factors resulting in transcriptional activation of cell cycle regulated genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Allele List at MGI

 All alleles(416) : Targeted, other(1) Gene trapped(415)

SNPs within 2kb(416 from dbSNP Build 128)  

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,597,046 probably benign Het
Ambn T C 5: 88,467,951 V413A possibly damaging Het
Amotl1 T A 9: 14,596,528 D41V probably damaging Het
Arhgef26 T C 3: 62,340,047 V184A probably benign Het
Birc6 G T 17: 74,618,502 G936V possibly damaging Het
Ccser1 T A 6: 61,311,242 S130T possibly damaging Het
Cecr2 A G 6: 120,720,907 I56V probably damaging Het
Cfap52 A G 11: 67,930,744 I486T probably damaging Het
Col4a3 A G 1: 82,716,329 I1557V possibly damaging Het
Col6a5 T A 9: 105,945,847 I104F unknown Het
Cry2 A G 2: 92,412,967 S510P probably benign Het
Csmd2 G C 4: 128,546,151 A3133P probably benign Het
Cyld G T 8: 88,732,993 A611S probably damaging Het
Dennd4c G A 4: 86,825,512 G1197E probably damaging Het
Dnah10 T C 5: 124,808,729 F2969L probably benign Het
Dnaic1 A G 4: 41,625,281 K415R probably benign Het
Dnmbp T A 19: 43,854,171 T1253S probably benign Het
Dsp T C 13: 38,195,702 L1542P possibly damaging Het
Duox1 T A 2: 122,340,201 L1234Q probably damaging Het
Efr3b T A 12: 3,968,590 R585S possibly damaging Het
Gpt A G 15: 76,699,352 probably null Het
Heatr6 G A 11: 83,753,718 probably benign Het
Kcns2 A G 15: 34,839,784 D431G probably benign Het
Kdm3b A G 18: 34,829,289 N1543D probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mical3 G A 6: 120,958,271 Q893* probably null Het
Morc3 C T 16: 93,866,453 H515Y possibly damaging Het
Mprip A T 11: 59,757,721 R750S probably damaging Het
Mroh1 G A 15: 76,451,491 V1436M probably benign Het
Muc5ac C T 7: 141,790,669 R69* probably null Het
Muc5b A T 7: 141,856,712 Y1274F unknown Het
Mybpc1 A G 10: 88,542,456 L674P probably damaging Het
Mypn A G 10: 63,131,023 V958A probably benign Het
Nipbl T C 15: 8,296,818 T2436A probably benign Het
Olfr835 A G 9: 19,035,147 D8G probably benign Het
Pcdhb5 T A 18: 37,321,773 L402Q probably damaging Het
Pigp T A 16: 94,370,194 probably null Het
Rp1 A G 1: 4,348,462 L809P probably benign Het
Scn3a T A 2: 65,494,781 probably benign Het
Sdf2 A T 11: 78,246,080 M29L probably benign Het
Serpina3b T G 12: 104,134,091 L311V possibly damaging Het
Snx31 A T 15: 36,523,488 Y349* probably null Het
Spidr A C 16: 16,114,869 C182W probably damaging Het
St13 A T 15: 81,377,798 S146R probably damaging Het
St8sia4 A G 1: 95,653,582 V145A probably damaging Het
Stradb T C 1: 58,980,016 probably null Het
Tcp11l2 T A 10: 84,594,797 probably benign Het
Tmprss15 C T 16: 79,057,659 R287H probably benign Het
Trav10d T C 14: 52,811,322 Y57H probably damaging Het
Vmn2r104 A G 17: 20,029,471 I846T probably benign Het
Ywhah T A 5: 33,026,948 M165K possibly damaging Het
Zfp324 C A 7: 12,969,366 P72T probably benign Het
Other mutations in Tfdp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01566:Tfdp2 APN 9 96295030 missense probably damaging 1.00
IGL01737:Tfdp2 APN 9 96300412 missense possibly damaging 0.79
IGL02725:Tfdp2 APN 9 96287695 missense possibly damaging 0.50
IGL02754:Tfdp2 APN 9 96317539 missense probably benign 0.08
IGL02975:Tfdp2 APN 9 96317936 unclassified probably benign
I2289:Tfdp2 UTSW 9 96317795 nonsense probably null
R0329:Tfdp2 UTSW 9 96306893 missense probably damaging 1.00
R0330:Tfdp2 UTSW 9 96306893 missense probably damaging 1.00
R0478:Tfdp2 UTSW 9 96290583 missense probably benign 0.01
R1843:Tfdp2 UTSW 9 96317804 missense possibly damaging 0.90
R1851:Tfdp2 UTSW 9 96297709 missense probably damaging 1.00
R2121:Tfdp2 UTSW 9 96295014 missense probably damaging 1.00
R2432:Tfdp2 UTSW 9 96310590 missense probably damaging 1.00
R4635:Tfdp2 UTSW 9 96297674 missense probably damaging 1.00
R7488:Tfdp2 UTSW 9 96297642 missense probably damaging 1.00
R7905:Tfdp2 UTSW 9 96310606 missense
R8222:Tfdp2 UTSW 9 96310613 missense possibly damaging 0.59
Z1177:Tfdp2 UTSW 9 96306858 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACGGGGCAGGATAATTGTC -3'
(R):5'- AGGCTCGTTAATTCAGGGGAG -3'

Sequencing Primer
(F):5'- GCAGGATAATTGTCCAGCTGTCAC -3'
(R):5'- CTCGTTAATTCAGGGGAGACAGC -3'
Posted On2017-03-31