Incidental Mutation 'R5970:Heatr6'
ID470813
Institutional Source Beutler Lab
Gene Symbol Heatr6
Ensembl Gene ENSMUSG00000000976
Gene NameHEAT repeat containing 6
Synonyms
MMRRC Submission 044153-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.722) question?
Stock #R5970 (G1)
Quality Score203
Status Validated
Chromosome11
Chromosomal Location83753696-83783754 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 83753718 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000064479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001002] [ENSMUST00000070832]
Predicted Effect probably benign
Transcript: ENSMUST00000001002
SMART Domains Protein: ENSMUSP00000001002
Gene: ENSMUSG00000000976

DomainStartEndE-ValueType
low complexity region 160 174 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
low complexity region 329 348 N/A INTRINSIC
low complexity region 391 402 N/A INTRINSIC
Pfam:DUF4042 421 602 9.6e-73 PFAM
low complexity region 603 627 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 1078 1091 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070832
SMART Domains Protein: ENSMUSP00000064479
Gene: ENSMUSG00000051748

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Blast:WAP 23 63 4e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125602
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125831
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,597,046 probably benign Het
Ambn T C 5: 88,467,951 V413A possibly damaging Het
Amotl1 T A 9: 14,596,528 D41V probably damaging Het
Arhgef26 T C 3: 62,340,047 V184A probably benign Het
Birc6 G T 17: 74,618,502 G936V possibly damaging Het
Ccser1 T A 6: 61,311,242 S130T possibly damaging Het
Cecr2 A G 6: 120,720,907 I56V probably damaging Het
Cfap52 A G 11: 67,930,744 I486T probably damaging Het
Col4a3 A G 1: 82,716,329 I1557V possibly damaging Het
Col6a5 T A 9: 105,945,847 I104F unknown Het
Cry2 A G 2: 92,412,967 S510P probably benign Het
Csmd2 G C 4: 128,546,151 A3133P probably benign Het
Cyld G T 8: 88,732,993 A611S probably damaging Het
Dennd4c G A 4: 86,825,512 G1197E probably damaging Het
Dnah10 T C 5: 124,808,729 F2969L probably benign Het
Dnaic1 A G 4: 41,625,281 K415R probably benign Het
Dnmbp T A 19: 43,854,171 T1253S probably benign Het
Dsp T C 13: 38,195,702 L1542P possibly damaging Het
Duox1 T A 2: 122,340,201 L1234Q probably damaging Het
Efr3b T A 12: 3,968,590 R585S possibly damaging Het
Gpt A G 15: 76,699,352 probably null Het
Kcns2 A G 15: 34,839,784 D431G probably benign Het
Kdm3b A G 18: 34,829,289 N1543D probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mical3 G A 6: 120,958,271 Q893* probably null Het
Morc3 C T 16: 93,866,453 H515Y possibly damaging Het
Mprip A T 11: 59,757,721 R750S probably damaging Het
Mroh1 G A 15: 76,451,491 V1436M probably benign Het
Muc5ac C T 7: 141,790,669 R69* probably null Het
Muc5b A T 7: 141,856,712 Y1274F unknown Het
Mybpc1 A G 10: 88,542,456 L674P probably damaging Het
Mypn A G 10: 63,131,023 V958A probably benign Het
Nipbl T C 15: 8,296,818 T2436A probably benign Het
Olfr835 A G 9: 19,035,147 D8G probably benign Het
Pcdhb5 T A 18: 37,321,773 L402Q probably damaging Het
Pigp T A 16: 94,370,194 probably null Het
Rp1 A G 1: 4,348,462 L809P probably benign Het
Scn3a T A 2: 65,494,781 probably benign Het
Sdf2 A T 11: 78,246,080 M29L probably benign Het
Serpina3b T G 12: 104,134,091 L311V possibly damaging Het
Snx31 A T 15: 36,523,488 Y349* probably null Het
Spidr A C 16: 16,114,869 C182W probably damaging Het
St13 A T 15: 81,377,798 S146R probably damaging Het
St8sia4 A G 1: 95,653,582 V145A probably damaging Het
Stradb T C 1: 58,980,016 probably null Het
Tcp11l2 T A 10: 84,594,797 probably benign Het
Tfdp2 C T 9: 96,317,574 P74S unknown Het
Tmprss15 C T 16: 79,057,659 R287H probably benign Het
Trav10d T C 14: 52,811,322 Y57H probably damaging Het
Vmn2r104 A G 17: 20,029,471 I846T probably benign Het
Ywhah T A 5: 33,026,948 M165K possibly damaging Het
Zfp324 C A 7: 12,969,366 P72T probably benign Het
Other mutations in Heatr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Heatr6 APN 11 83759309 missense probably damaging 1.00
IGL01681:Heatr6 APN 11 83765000 missense probably benign 0.08
IGL01905:Heatr6 APN 11 83781712 missense probably benign 0.06
IGL02037:Heatr6 APN 11 83764882 splice site probably benign
IGL02313:Heatr6 APN 11 83778892 missense probably damaging 1.00
IGL02652:Heatr6 APN 11 83769732 missense probably damaging 1.00
IGL03004:Heatr6 APN 11 83757379 missense probably benign 0.01
IGL03229:Heatr6 APN 11 83781445 missense probably benign 0.01
IGL03386:Heatr6 APN 11 83759377 missense probably damaging 1.00
IGL02802:Heatr6 UTSW 11 83760936 missense probably damaging 1.00
R0537:Heatr6 UTSW 11 83779464 nonsense probably null
R1658:Heatr6 UTSW 11 83758367 missense probably damaging 1.00
R1864:Heatr6 UTSW 11 83769230 missense probably damaging 0.97
R1893:Heatr6 UTSW 11 83757314 missense probably benign 0.33
R1944:Heatr6 UTSW 11 83769220 missense probably damaging 1.00
R2115:Heatr6 UTSW 11 83757455 unclassified probably benign
R3019:Heatr6 UTSW 11 83778832 splice site probably null
R4050:Heatr6 UTSW 11 83755773 missense probably damaging 0.99
R4532:Heatr6 UTSW 11 83769672 missense probably damaging 1.00
R4576:Heatr6 UTSW 11 83765000 missense probably benign 0.08
R4724:Heatr6 UTSW 11 83779548 nonsense probably null
R4825:Heatr6 UTSW 11 83758322 missense probably damaging 1.00
R5489:Heatr6 UTSW 11 83774432 missense probably damaging 1.00
R6136:Heatr6 UTSW 11 83772503 missense possibly damaging 0.94
R6145:Heatr6 UTSW 11 83766136 missense probably damaging 1.00
R6649:Heatr6 UTSW 11 83759365 missense probably benign 0.01
R6653:Heatr6 UTSW 11 83759365 missense probably benign 0.01
R6791:Heatr6 UTSW 11 83758341 missense probably benign
R6865:Heatr6 UTSW 11 83769140 missense probably damaging 1.00
R7154:Heatr6 UTSW 11 83777241 missense probably benign 0.05
R7385:Heatr6 UTSW 11 83759335 missense probably damaging 0.96
R7473:Heatr6 UTSW 11 83781391 missense probably damaging 1.00
R7959:Heatr6 UTSW 11 83781363 nonsense probably null
R8034:Heatr6 UTSW 11 83753909 missense probably benign 0.01
R8202:Heatr6 UTSW 11 83759408 missense possibly damaging 0.53
R8398:Heatr6 UTSW 11 83781338 missense probably benign 0.01
R8472:Heatr6 UTSW 11 83765853 missense probably benign 0.34
R8704:Heatr6 UTSW 11 83777278 missense probably benign 0.09
X0014:Heatr6 UTSW 11 83781250 missense probably damaging 0.97
Z1177:Heatr6 UTSW 11 83766081 missense probably benign 0.00
Z1177:Heatr6 UTSW 11 83781382 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGAAACTCTAGCAACGTCAGC -3'
(R):5'- TTCTCGGAGATGAGCTGGTC -3'

Sequencing Primer
(F):5'- TGCCCAAGAGCAAACTTTCTGAG -3'
(R):5'- TCGAAGAGCAGGTGAATCTCC -3'
Posted On2017-03-31