Incidental Mutation 'R5970:Snx31'
ID470822
Institutional Source Beutler Lab
Gene Symbol Snx31
Ensembl Gene ENSMUSG00000013611
Gene Namesorting nexin 31
Synonyms4631426E05Rik
MMRRC Submission 044153-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5970 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location36504062-36555573 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 36523488 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 349 (Y349*)
Ref Sequence ENSEMBL: ENSMUSP00000124063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013755] [ENSMUST00000161202]
Predicted Effect probably null
Transcript: ENSMUST00000013755
AA Change: Y349*
SMART Domains Protein: ENSMUSP00000013755
Gene: ENSMUSG00000013611
AA Change: Y349*

DomainStartEndE-ValueType
PX 1 105 5.44e-9 SMART
PDB:4GXB|A 112 382 1e-64 PDB
Blast:B41 115 324 1e-49 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000161202
AA Change: Y349*
SMART Domains Protein: ENSMUSP00000124063
Gene: ENSMUSG00000013611
AA Change: Y349*

DomainStartEndE-ValueType
PX 1 105 5.44e-9 SMART
PDB:4GXB|A 112 382 1e-64 PDB
Blast:B41 115 324 1e-49 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,597,046 probably benign Het
Ambn T C 5: 88,467,951 V413A possibly damaging Het
Amotl1 T A 9: 14,596,528 D41V probably damaging Het
Arhgef26 T C 3: 62,340,047 V184A probably benign Het
Birc6 G T 17: 74,618,502 G936V possibly damaging Het
Ccser1 T A 6: 61,311,242 S130T possibly damaging Het
Cecr2 A G 6: 120,720,907 I56V probably damaging Het
Cfap52 A G 11: 67,930,744 I486T probably damaging Het
Col4a3 A G 1: 82,716,329 I1557V possibly damaging Het
Col6a5 T A 9: 105,945,847 I104F unknown Het
Cry2 A G 2: 92,412,967 S510P probably benign Het
Csmd2 G C 4: 128,546,151 A3133P probably benign Het
Cyld G T 8: 88,732,993 A611S probably damaging Het
Dennd4c G A 4: 86,825,512 G1197E probably damaging Het
Dnah10 T C 5: 124,808,729 F2969L probably benign Het
Dnaic1 A G 4: 41,625,281 K415R probably benign Het
Dnmbp T A 19: 43,854,171 T1253S probably benign Het
Dsp T C 13: 38,195,702 L1542P possibly damaging Het
Duox1 T A 2: 122,340,201 L1234Q probably damaging Het
Efr3b T A 12: 3,968,590 R585S possibly damaging Het
Gpt A G 15: 76,699,352 probably null Het
Heatr6 G A 11: 83,753,718 probably benign Het
Kcns2 A G 15: 34,839,784 D431G probably benign Het
Kdm3b A G 18: 34,829,289 N1543D probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mical3 G A 6: 120,958,271 Q893* probably null Het
Morc3 C T 16: 93,866,453 H515Y possibly damaging Het
Mprip A T 11: 59,757,721 R750S probably damaging Het
Mroh1 G A 15: 76,451,491 V1436M probably benign Het
Muc5ac C T 7: 141,790,669 R69* probably null Het
Muc5b A T 7: 141,856,712 Y1274F unknown Het
Mybpc1 A G 10: 88,542,456 L674P probably damaging Het
Mypn A G 10: 63,131,023 V958A probably benign Het
Nipbl T C 15: 8,296,818 T2436A probably benign Het
Olfr835 A G 9: 19,035,147 D8G probably benign Het
Pcdhb5 T A 18: 37,321,773 L402Q probably damaging Het
Pigp T A 16: 94,370,194 probably null Het
Rp1 A G 1: 4,348,462 L809P probably benign Het
Scn3a T A 2: 65,494,781 probably benign Het
Sdf2 A T 11: 78,246,080 M29L probably benign Het
Serpina3b T G 12: 104,134,091 L311V possibly damaging Het
Spidr A C 16: 16,114,869 C182W probably damaging Het
St13 A T 15: 81,377,798 S146R probably damaging Het
St8sia4 A G 1: 95,653,582 V145A probably damaging Het
Stradb T C 1: 58,980,016 probably null Het
Tcp11l2 T A 10: 84,594,797 probably benign Het
Tfdp2 C T 9: 96,317,574 P74S unknown Het
Tmprss15 C T 16: 79,057,659 R287H probably benign Het
Trav10d T C 14: 52,811,322 Y57H probably damaging Het
Vmn2r104 A G 17: 20,029,471 I846T probably benign Het
Ywhah T A 5: 33,026,948 M165K possibly damaging Het
Zfp324 C A 7: 12,969,366 P72T probably benign Het
Other mutations in Snx31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Snx31 APN 15 36545616 critical splice acceptor site probably null
IGL01627:Snx31 APN 15 36517672 missense probably damaging 1.00
IGL02514:Snx31 APN 15 36525582 missense probably damaging 1.00
IGL03069:Snx31 APN 15 36525603 nonsense probably null
IGL03182:Snx31 APN 15 36525687 missense probably benign 0.00
R0755:Snx31 UTSW 15 36534430 missense probably damaging 0.99
R1005:Snx31 UTSW 15 36517691 splice site probably benign
R1463:Snx31 UTSW 15 36539298 missense probably null 1.00
R1513:Snx31 UTSW 15 36545600 missense probably damaging 0.99
R2030:Snx31 UTSW 15 36525702 missense probably benign 0.31
R3404:Snx31 UTSW 15 36525653 missense probably benign 0.00
R3720:Snx31 UTSW 15 36523558 critical splice acceptor site probably null
R4152:Snx31 UTSW 15 36525639 missense probably benign
R4474:Snx31 UTSW 15 36546111 intron probably benign
R4729:Snx31 UTSW 15 36523552 missense possibly damaging 0.92
R4998:Snx31 UTSW 15 36539367 missense probably damaging 0.96
R5010:Snx31 UTSW 15 36555324 missense probably damaging 1.00
R5375:Snx31 UTSW 15 36525584 missense probably damaging 0.99
R5893:Snx31 UTSW 15 36523455 missense probably damaging 0.98
R6211:Snx31 UTSW 15 36546885 missense probably damaging 0.98
R7198:Snx31 UTSW 15 36555310 missense probably benign 0.04
R7293:Snx31 UTSW 15 36523450 missense probably damaging 0.97
R7329:Snx31 UTSW 15 36555476 missense probably benign 0.00
R7741:Snx31 UTSW 15 36523441 critical splice donor site probably null
R8057:Snx31 UTSW 15 36523460 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATTTCAGTCCCGTGCCAGTG -3'
(R):5'- AACTTTGCCCCTCTGGATGG -3'

Sequencing Primer
(F):5'- TCCCGTGCCAGTGAAGGAC -3'
(R):5'- TGCTGAGTTACTGCCACG -3'
Posted On2017-03-31