Incidental Mutation 'R5970:Gpt'
ID470824
Institutional Source Beutler Lab
Gene Symbol Gpt
Ensembl Gene ENSMUSG00000022546
Gene Nameglutamic pyruvic transaminase, soluble
Synonyms1300007J06Rik, Gpt1, Gpt-1, 2310022B03Rik, ALT
MMRRC Submission 044153-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5970 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76695716-76699686 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 76699352 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000023203] [ENSMUST00000036852] [ENSMUST00000037551] [ENSMUST00000135388] [ENSMUST00000150399] [ENSMUST00000229140] [ENSMUST00000230544] [ENSMUST00000229734] [ENSMUST00000231028] [ENSMUST00000229679] [ENSMUST00000230724]
Predicted Effect probably benign
Transcript: ENSMUST00000019224
SMART Domains Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080

DomainStartEndE-ValueType
Pfam:MFS_1 8 373 3e-16 PFAM
transmembrane domain 388 407 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000023203
SMART Domains Protein: ENSMUSP00000023203
Gene: ENSMUSG00000022546

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 83 484 7.8e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000036852
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000037551
SMART Domains Protein: ENSMUSP00000037356
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
ANK 231 260 2.58e-3 SMART
ANK 264 293 4.03e-5 SMART
low complexity region 323 346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134449
Predicted Effect probably benign
Transcript: ENSMUST00000135388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140730
Predicted Effect probably benign
Transcript: ENSMUST00000150399
SMART Domains Protein: ENSMUSP00000123458
Gene: ENSMUSG00000033819

DomainStartEndE-ValueType
ANK 70 99 2.5e3 SMART
ANK 103 132 3.41e-3 SMART
ANK 136 165 2.66e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229098
Predicted Effect probably null
Transcript: ENSMUST00000229140
Predicted Effect probably benign
Transcript: ENSMUST00000230544
Predicted Effect probably benign
Transcript: ENSMUST00000229734
Predicted Effect probably benign
Transcript: ENSMUST00000231028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229340
Predicted Effect probably null
Transcript: ENSMUST00000229679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230283
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230482
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes cytosolic alanine aminotransaminase 1 (ALT1); also known as glutamate-pyruvate transaminase 1. This enzyme catalyzes the reversible transamination between alanine and 2-oxoglutarate to generate pyruvate and glutamate and, therefore, plays a key role in the intermediary metabolism of glucose and amino acids. Serum activity levels of this enzyme are routinely used as a biomarker of liver injury caused by drug toxicity, infection, alcohol, and steatosis. A related gene on chromosome 16 encodes a putative mitochondrial alanine aminotransaminase.[provided by RefSeq, Nov 2009]
PHENOTYPE: Electrophoretic variants are detected in C57BL/6, BALB/c and DBA/2 (a allele); in MA/J and NZB/Bl (b allele). M. m. molossinus and M. m. castaneus have either the b or c allele. In liver, GPT1 activity rises dramatically at 12-19 days to adult levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,597,046 probably benign Het
Ambn T C 5: 88,467,951 V413A possibly damaging Het
Amotl1 T A 9: 14,596,528 D41V probably damaging Het
Arhgef26 T C 3: 62,340,047 V184A probably benign Het
Birc6 G T 17: 74,618,502 G936V possibly damaging Het
Ccser1 T A 6: 61,311,242 S130T possibly damaging Het
Cecr2 A G 6: 120,720,907 I56V probably damaging Het
Cfap52 A G 11: 67,930,744 I486T probably damaging Het
Col4a3 A G 1: 82,716,329 I1557V possibly damaging Het
Col6a5 T A 9: 105,945,847 I104F unknown Het
Cry2 A G 2: 92,412,967 S510P probably benign Het
Csmd2 G C 4: 128,546,151 A3133P probably benign Het
Cyld G T 8: 88,732,993 A611S probably damaging Het
Dennd4c G A 4: 86,825,512 G1197E probably damaging Het
Dnah10 T C 5: 124,808,729 F2969L probably benign Het
Dnaic1 A G 4: 41,625,281 K415R probably benign Het
Dnmbp T A 19: 43,854,171 T1253S probably benign Het
Dsp T C 13: 38,195,702 L1542P possibly damaging Het
Duox1 T A 2: 122,340,201 L1234Q probably damaging Het
Efr3b T A 12: 3,968,590 R585S possibly damaging Het
Heatr6 G A 11: 83,753,718 probably benign Het
Kcns2 A G 15: 34,839,784 D431G probably benign Het
Kdm3b A G 18: 34,829,289 N1543D probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mical3 G A 6: 120,958,271 Q893* probably null Het
Morc3 C T 16: 93,866,453 H515Y possibly damaging Het
Mprip A T 11: 59,757,721 R750S probably damaging Het
Mroh1 G A 15: 76,451,491 V1436M probably benign Het
Muc5ac C T 7: 141,790,669 R69* probably null Het
Muc5b A T 7: 141,856,712 Y1274F unknown Het
Mybpc1 A G 10: 88,542,456 L674P probably damaging Het
Mypn A G 10: 63,131,023 V958A probably benign Het
Nipbl T C 15: 8,296,818 T2436A probably benign Het
Olfr835 A G 9: 19,035,147 D8G probably benign Het
Pcdhb5 T A 18: 37,321,773 L402Q probably damaging Het
Pigp T A 16: 94,370,194 probably null Het
Rp1 A G 1: 4,348,462 L809P probably benign Het
Scn3a T A 2: 65,494,781 probably benign Het
Sdf2 A T 11: 78,246,080 M29L probably benign Het
Serpina3b T G 12: 104,134,091 L311V possibly damaging Het
Snx31 A T 15: 36,523,488 Y349* probably null Het
Spidr A C 16: 16,114,869 C182W probably damaging Het
St13 A T 15: 81,377,798 S146R probably damaging Het
St8sia4 A G 1: 95,653,582 V145A probably damaging Het
Stradb T C 1: 58,980,016 probably null Het
Tcp11l2 T A 10: 84,594,797 probably benign Het
Tfdp2 C T 9: 96,317,574 P74S unknown Het
Tmprss15 C T 16: 79,057,659 R287H probably benign Het
Trav10d T C 14: 52,811,322 Y57H probably damaging Het
Vmn2r104 A G 17: 20,029,471 I846T probably benign Het
Ywhah T A 5: 33,026,948 M165K possibly damaging Het
Zfp324 C A 7: 12,969,366 P72T probably benign Het
Other mutations in Gpt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Gpt APN 15 76698782 missense probably damaging 1.00
IGL02061:Gpt APN 15 76699417 unclassified probably benign
IGL03027:Gpt APN 15 76698089 unclassified probably benign
R2091:Gpt UTSW 15 76697976 missense possibly damaging 0.87
R2903:Gpt UTSW 15 76698466 missense probably damaging 1.00
R3835:Gpt UTSW 15 76698583 missense probably damaging 1.00
R4496:Gpt UTSW 15 76698463 missense probably damaging 1.00
R4855:Gpt UTSW 15 76699285 missense probably damaging 0.99
R4932:Gpt UTSW 15 76698840 missense probably benign 0.05
R6165:Gpt UTSW 15 76697970 missense probably benign 0.28
R6914:Gpt UTSW 15 76697592 missense probably benign
R7204:Gpt UTSW 15 76698999 missense probably benign 0.00
R7397:Gpt UTSW 15 76698517 missense probably benign 0.05
R7654:Gpt UTSW 15 76698330 missense probably benign 0.37
R7808:Gpt UTSW 15 76698893 splice site probably null
R8057:Gpt UTSW 15 76696772 intron probably benign
R8389:Gpt UTSW 15 76699042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCAGCTGCCTTTGAAAGCAG -3'
(R):5'- CAGTGGCTTCAGGAGTACTC -3'

Sequencing Primer
(F):5'- CTGCCTTTGAAAGCAGTGCAG -3'
(R):5'- CAGGAGTACTCATGAGTGAATTTAGC -3'
Posted On2017-03-31