Incidental Mutation 'R5970:Tmprss15'
ID 470826
Institutional Source Beutler Lab
Gene Symbol Tmprss15
Ensembl Gene ENSMUSG00000022857
Gene Name transmembrane protease, serine 15
Synonyms A130097D21Rik, enterokinase, enteropeptidase, Prss7
MMRRC Submission 044153-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5970 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 78953008-79091097 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 79057659 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 287 (R287H)
Ref Sequence ENSEMBL: ENSMUSP00000023566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023566] [ENSMUST00000060402]
AlphaFold P97435
Predicted Effect probably benign
Transcript: ENSMUST00000023566
AA Change: R287H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023566
Gene: ENSMUSG00000022857
AA Change: R287H

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 228 268 1.74e-4 SMART
CUB 270 379 1.54e-11 SMART
MAM 387 549 7.33e-54 SMART
low complexity region 551 567 N/A INTRINSIC
CUB 569 679 1.72e-32 SMART
LDLa 687 724 7.32e-12 SMART
SR 723 813 3.12e-5 SMART
Tryp_SPc 829 1064 1.48e-95 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060402
AA Change: R272H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052034
Gene: ENSMUSG00000022857
AA Change: R272H

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 213 253 1.74e-4 SMART
CUB 255 364 1.54e-11 SMART
MAM 372 534 7.33e-54 SMART
low complexity region 536 552 N/A INTRINSIC
CUB 554 664 1.72e-32 SMART
LDLa 672 709 7.32e-12 SMART
SR 708 798 3.12e-5 SMART
Tryp_SPc 814 1049 1.48e-95 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes an enzyme that proteolytically activates the pancreatic proenzyme trypsinogen, converting it into trypsin. The encoded protein is cleaved into two chains that form a heterodimer linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,597,046 probably benign Het
Ambn T C 5: 88,467,951 V413A possibly damaging Het
Amotl1 T A 9: 14,596,528 D41V probably damaging Het
Arhgef26 T C 3: 62,340,047 V184A probably benign Het
Birc6 G T 17: 74,618,502 G936V possibly damaging Het
Ccser1 T A 6: 61,311,242 S130T possibly damaging Het
Cecr2 A G 6: 120,720,907 I56V probably damaging Het
Cfap52 A G 11: 67,930,744 I486T probably damaging Het
Col4a3 A G 1: 82,716,329 I1557V possibly damaging Het
Col6a5 T A 9: 105,945,847 I104F unknown Het
Cry2 A G 2: 92,412,967 S510P probably benign Het
Csmd2 G C 4: 128,546,151 A3133P probably benign Het
Cyld G T 8: 88,732,993 A611S probably damaging Het
Dennd4c G A 4: 86,825,512 G1197E probably damaging Het
Dnah10 T C 5: 124,808,729 F2969L probably benign Het
Dnaic1 A G 4: 41,625,281 K415R probably benign Het
Dnmbp T A 19: 43,854,171 T1253S probably benign Het
Dsp T C 13: 38,195,702 L1542P possibly damaging Het
Duox1 T A 2: 122,340,201 L1234Q probably damaging Het
Efr3b T A 12: 3,968,590 R585S possibly damaging Het
Gpt A G 15: 76,699,352 probably null Het
Heatr6 G A 11: 83,753,718 probably benign Het
Kcns2 A G 15: 34,839,784 D431G probably benign Het
Kdm3b A G 18: 34,829,289 N1543D probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mical3 G A 6: 120,958,271 Q893* probably null Het
Morc3 C T 16: 93,866,453 H515Y possibly damaging Het
Mprip A T 11: 59,757,721 R750S probably damaging Het
Mroh1 G A 15: 76,451,491 V1436M probably benign Het
Muc5ac C T 7: 141,790,669 R69* probably null Het
Muc5b A T 7: 141,856,712 Y1274F unknown Het
Mybpc1 A G 10: 88,542,456 L674P probably damaging Het
Mypn A G 10: 63,131,023 V958A probably benign Het
Nipbl T C 15: 8,296,818 T2436A probably benign Het
Olfr835 A G 9: 19,035,147 D8G probably benign Het
Pcdhb5 T A 18: 37,321,773 L402Q probably damaging Het
Pigp T A 16: 94,370,194 probably null Het
Rp1 A G 1: 4,348,462 L809P probably benign Het
Scn3a T A 2: 65,494,781 probably benign Het
Sdf2 A T 11: 78,246,080 M29L probably benign Het
Serpina3b T G 12: 104,134,091 L311V possibly damaging Het
Snx31 A T 15: 36,523,488 Y349* probably null Het
Spidr A C 16: 16,114,869 C182W probably damaging Het
St13 A T 15: 81,377,798 S146R probably damaging Het
St8sia4 A G 1: 95,653,582 V145A probably damaging Het
Stradb T C 1: 58,980,016 probably null Het
Tcp11l2 T A 10: 84,594,797 probably benign Het
Tfdp2 C T 9: 96,317,574 P74S unknown Het
Trav10d T C 14: 52,811,322 Y57H probably damaging Het
Vmn2r104 A G 17: 20,029,471 I846T probably benign Het
Ywhah T A 5: 33,026,948 M165K possibly damaging Het
Zfp324 C A 7: 12,969,366 P72T probably benign Het
Other mutations in Tmprss15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Tmprss15 APN 16 78985994 missense possibly damaging 0.87
IGL00477:Tmprss15 APN 16 79021413 missense probably damaging 1.00
IGL01583:Tmprss15 APN 16 79071261 missense probably benign
IGL01896:Tmprss15 APN 16 79090790 missense probably benign 0.22
IGL02052:Tmprss15 APN 16 79087506 missense probably damaging 1.00
IGL02374:Tmprss15 APN 16 79035168 missense probably benign 0.00
IGL02505:Tmprss15 APN 16 78987741 missense probably benign 0.00
IGL02632:Tmprss15 APN 16 78985902 missense probably damaging 0.98
IGL02674:Tmprss15 APN 16 79001794 missense possibly damaging 0.72
beached UTSW 16 79024848 missense possibly damaging 0.62
Cellulite UTSW 16 78957371 missense probably damaging 1.00
lolling UTSW 16 79003410 missense probably benign 0.26
miniature UTSW 16 79057609 critical splice donor site probably null
PIT1430001:Tmprss15 UTSW 16 79024752 critical splice donor site probably null
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0195:Tmprss15 UTSW 16 79034334 missense probably benign 0.05
R0335:Tmprss15 UTSW 16 79024742 splice site probably benign
R0514:Tmprss15 UTSW 16 78968267 missense probably benign 0.05
R0552:Tmprss15 UTSW 16 79024749 splice site probably null
R0675:Tmprss15 UTSW 16 78985950 missense probably damaging 0.98
R0739:Tmprss15 UTSW 16 79024848 missense possibly damaging 0.62
R1435:Tmprss15 UTSW 16 79021454 missense probably benign 0.03
R1446:Tmprss15 UTSW 16 79078958 missense probably benign 0.01
R1572:Tmprss15 UTSW 16 79090829 missense probably benign 0.00
R1708:Tmprss15 UTSW 16 79054070 missense possibly damaging 0.95
R1893:Tmprss15 UTSW 16 79071418 missense probably benign
R2403:Tmprss15 UTSW 16 79057690 missense probably damaging 1.00
R2866:Tmprss15 UTSW 16 79035233 missense possibly damaging 0.65
R2913:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R2914:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R3425:Tmprss15 UTSW 16 79003433 missense possibly damaging 0.83
R3703:Tmprss15 UTSW 16 79054142 critical splice acceptor site probably null
R3916:Tmprss15 UTSW 16 78985996 missense probably damaging 1.00
R3950:Tmprss15 UTSW 16 79073186 missense probably benign 0.04
R4332:Tmprss15 UTSW 16 79034334 missense probably benign 0.15
R4392:Tmprss15 UTSW 16 79024438 missense probably damaging 1.00
R4515:Tmprss15 UTSW 16 78957356 missense probably benign 0.00
R4619:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4620:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4754:Tmprss15 UTSW 16 79054124 missense probably damaging 0.98
R4853:Tmprss15 UTSW 16 78960591 missense probably benign
R5159:Tmprss15 UTSW 16 79003410 missense probably benign 0.26
R5441:Tmprss15 UTSW 16 79071447 critical splice acceptor site probably null
R5824:Tmprss15 UTSW 16 79034313 missense probably damaging 0.99
R6224:Tmprss15 UTSW 16 79024378 missense probably benign 0.08
R6257:Tmprss15 UTSW 16 78972225 missense probably damaging 1.00
R6313:Tmprss15 UTSW 16 78962170 missense probably benign 0.16
R6368:Tmprss15 UTSW 16 79006057 splice site probably null
R6525:Tmprss15 UTSW 16 79003378 missense probably damaging 0.97
R6587:Tmprss15 UTSW 16 79071429 missense probably benign
R6894:Tmprss15 UTSW 16 79075814 nonsense probably null
R7018:Tmprss15 UTSW 16 79024853 missense possibly damaging 0.78
R7180:Tmprss15 UTSW 16 78967998 missense probably damaging 0.97
R7324:Tmprss15 UTSW 16 78962019 missense probably damaging 1.00
R7337:Tmprss15 UTSW 16 79071276 missense probably benign 0.01
R7558:Tmprss15 UTSW 16 79003414 missense possibly damaging 0.55
R7732:Tmprss15 UTSW 16 79003420 missense probably benign 0.11
R7792:Tmprss15 UTSW 16 79003387 missense probably damaging 1.00
R7829:Tmprss15 UTSW 16 78987650 missense probably benign 0.02
R7998:Tmprss15 UTSW 16 79001843 missense possibly damaging 0.79
R8009:Tmprss15 UTSW 16 79090863 missense probably damaging 0.96
R8145:Tmprss15 UTSW 16 78960585 missense probably damaging 1.00
R8183:Tmprss15 UTSW 16 79087512 missense probably benign 0.04
R8221:Tmprss15 UTSW 16 79024335 missense probably damaging 0.99
R8294:Tmprss15 UTSW 16 79071288 missense probably benign
R8537:Tmprss15 UTSW 16 79087515 missense probably damaging 0.99
R8735:Tmprss15 UTSW 16 79001814 missense possibly damaging 0.88
R8858:Tmprss15 UTSW 16 79057609 critical splice donor site probably null
R8869:Tmprss15 UTSW 16 78953946 nonsense probably null
R8884:Tmprss15 UTSW 16 79024769 missense probably benign 0.00
R9014:Tmprss15 UTSW 16 79075803 missense probably benign 0.04
R9075:Tmprss15 UTSW 16 78957371 missense probably damaging 1.00
R9351:Tmprss15 UTSW 16 79035198 missense probably damaging 1.00
R9393:Tmprss15 UTSW 16 78957323 missense probably benign 0.01
R9747:Tmprss15 UTSW 16 79087512 missense probably benign 0.04
R9767:Tmprss15 UTSW 16 79079089 missense probably damaging 1.00
R9783:Tmprss15 UTSW 16 79091002 start gained probably benign
RF005:Tmprss15 UTSW 16 78953801 makesense probably null
Predicted Primers PCR Primer
(F):5'- CACATAGCTTTTCTTGGTACAGAG -3'
(R):5'- CATTGTCACGGGGAAATGCAG -3'

Sequencing Primer
(F):5'- CTTGAAAGAGAAACTTGAGACAGTC -3'
(R):5'- GGAAATGCAGATAGAAGCCTCTAG -3'
Posted On 2017-03-31