Incidental Mutation 'R5970:Pigp'
ID470828
Institutional Source Beutler Lab
Gene Symbol Pigp
Ensembl Gene ENSMUSG00000022940
Gene Namephosphatidylinositol glycan anchor biosynthesis, class P
SynonymsDcrc, Dscr5
MMRRC Submission 044153-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.712) question?
Stock #R5970 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location94358763-94371842 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 94370194 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113905] [ENSMUST00000113905] [ENSMUST00000113905] [ENSMUST00000113906] [ENSMUST00000113906] [ENSMUST00000113906] [ENSMUST00000113910] [ENSMUST00000113910] [ENSMUST00000113910] [ENSMUST00000113914] [ENSMUST00000113914] [ENSMUST00000113914] [ENSMUST00000113917] [ENSMUST00000117648] [ENSMUST00000119131] [ENSMUST00000122895] [ENSMUST00000138514] [ENSMUST00000139513] [ENSMUST00000141856] [ENSMUST00000143145] [ENSMUST00000145432] [ENSMUST00000145883] [ENSMUST00000147046] [ENSMUST00000147352] [ENSMUST00000149885] [ENSMUST00000150097] [ENSMUST00000150346] [ENSMUST00000151770] [ENSMUST00000152117] [ENSMUST00000153062] [ENSMUST00000153988] [ENSMUST00000154243] [ENSMUST00000155692] [ENSMUST00000231569] [ENSMUST00000232294] [ENSMUST00000232294] [ENSMUST00000232294]
Predicted Effect probably null
Transcript: ENSMUST00000113905
SMART Domains Protein: ENSMUSP00000109538
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 10 125 7.6e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113905
SMART Domains Protein: ENSMUSP00000109538
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 10 125 7.6e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113905
SMART Domains Protein: ENSMUSP00000109538
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 10 125 7.6e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113906
SMART Domains Protein: ENSMUSP00000109539
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 10 125 7.6e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113906
SMART Domains Protein: ENSMUSP00000109539
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 10 125 7.6e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113906
SMART Domains Protein: ENSMUSP00000109539
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 10 125 7.6e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113910
SMART Domains Protein: ENSMUSP00000109543
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 39 154 1.5e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113910
SMART Domains Protein: ENSMUSP00000109543
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 39 154 1.5e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113910
SMART Domains Protein: ENSMUSP00000109543
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
Pfam:PIG-P 39 154 1.5e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113914
SMART Domains Protein: ENSMUSP00000109547
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
Pfam:PIG-P 84 197 1e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113914
SMART Domains Protein: ENSMUSP00000109547
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
Pfam:PIG-P 84 197 1e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113914
SMART Domains Protein: ENSMUSP00000109547
Gene: ENSMUSG00000022940

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
Pfam:PIG-P 84 197 1e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113917
AA Change: R26*
SMART Domains Protein: ENSMUSP00000109550
Gene: ENSMUSG00000022940
AA Change: R26*

DomainStartEndE-ValueType
Pfam:PIG-P 43 135 5.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117648
SMART Domains Protein: ENSMUSP00000112801
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 2e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
low complexity region 1170 1190 N/A INTRINSIC
low complexity region 1248 1260 N/A INTRINSIC
low complexity region 1278 1291 N/A INTRINSIC
coiled coil region 1472 1570 N/A INTRINSIC
low complexity region 1876 1887 N/A INTRINSIC
RING 1931 1970 7e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119131
SMART Domains Protein: ENSMUSP00000113311
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_11 229 285 1.1e-12 PFAM
Pfam:TPR_1 232 264 2.1e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122895
SMART Domains Protein: ENSMUSP00000123037
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127667
SMART Domains Protein: ENSMUSP00000122425
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_11 22 89 4.7e-16 PFAM
Pfam:TPR_2 24 57 5.7e-4 PFAM
Pfam:TPR_1 25 57 3.5e-5 PFAM
Pfam:TPR_9 35 103 3.2e-6 PFAM
Pfam:TPR_1 58 89 2.1e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130960
Predicted Effect probably null
Transcript: ENSMUST00000138514
AA Change: R26*
SMART Domains Protein: ENSMUSP00000114477
Gene: ENSMUSG00000022940
AA Change: R26*

DomainStartEndE-ValueType
Pfam:PIG-P 43 152 1.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139513
SMART Domains Protein: ENSMUSP00000117881
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141856
SMART Domains Protein: ENSMUSP00000117369
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_1 90 121 1e-6 PFAM
Pfam:TPR_2 90 121 7.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143145
Predicted Effect probably benign
Transcript: ENSMUST00000145432
Predicted Effect probably benign
Transcript: ENSMUST00000145883
SMART Domains Protein: ENSMUSP00000123442
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
transmembrane domain 42 64 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146924
Predicted Effect probably benign
Transcript: ENSMUST00000147046
SMART Domains Protein: ENSMUSP00000119265
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 5.3e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
low complexity region 359 382 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147352
SMART Domains Protein: ENSMUSP00000116097
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 213 246 3.61e-2 SMART
TPR 247 280 3.32e-1 SMART
Blast:TPR 282 314 3e-12 BLAST
low complexity region 426 441 N/A INTRINSIC
TPR 558 591 2.55e-2 SMART
low complexity region 702 714 N/A INTRINSIC
coiled coil region 747 778 N/A INTRINSIC
low complexity region 1000 1014 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149753
Predicted Effect probably benign
Transcript: ENSMUST00000149885
SMART Domains Protein: ENSMUSP00000122006
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Pfam:TPR_2 1 31 3.5e-4 PFAM
Pfam:TPR_11 1 58 7.8e-16 PFAM
Pfam:TPR_1 2 31 1.8e-5 PFAM
Pfam:TPR_9 9 58 2.5e-6 PFAM
Pfam:TPR_17 20 53 4.2e-7 PFAM
Pfam:TPR_1 32 58 2.5e-4 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150097
SMART Domains Protein: ENSMUSP00000119035
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Blast:TPR 1 22 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150346
SMART Domains Protein: ENSMUSP00000122726
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
Pfam:TPR_1 175 206 9.6e-6 PFAM
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151192
Predicted Effect probably benign
Transcript: ENSMUST00000151770
SMART Domains Protein: ENSMUSP00000121349
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 231 264 3.61e-2 SMART
TPR 265 298 3.32e-1 SMART
Blast:TPR 300 332 3e-12 BLAST
low complexity region 444 459 N/A INTRINSIC
TPR 576 609 2.55e-2 SMART
low complexity region 720 732 N/A INTRINSIC
coiled coil region 765 796 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
low complexity region 1036 1050 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152117
SMART Domains Protein: ENSMUSP00000116896
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
low complexity region 43 58 N/A INTRINSIC
SCOP:d1ihga1 69 201 6e-8 SMART
Blast:TPR 175 208 1e-14 BLAST
low complexity region 319 331 N/A INTRINSIC
coiled coil region 364 395 N/A INTRINSIC
low complexity region 617 631 N/A INTRINSIC
low complexity region 635 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153062
Predicted Effect probably benign
Transcript: ENSMUST00000153988
SMART Domains Protein: ENSMUSP00000118763
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
Blast:TPR 1 22 3e-6 BLAST
low complexity region 134 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154243
Predicted Effect probably benign
Transcript: ENSMUST00000155692
SMART Domains Protein: ENSMUSP00000122724
Gene: ENSMUSG00000040785

DomainStartEndE-ValueType
TPR 250 283 3.61e-2 SMART
TPR 284 317 3.32e-1 SMART
Blast:TPR 319 351 3e-12 BLAST
low complexity region 463 478 N/A INTRINSIC
TPR 595 628 2.55e-2 SMART
low complexity region 739 751 N/A INTRINSIC
coiled coil region 784 815 N/A INTRINSIC
low complexity region 1037 1051 N/A INTRINSIC
low complexity region 1055 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231569
Predicted Effect probably null
Transcript: ENSMUST00000232294
Predicted Effect probably null
Transcript: ENSMUST00000232294
Predicted Effect probably null
Transcript: ENSMUST00000232294
Meta Mutation Damage Score 0.9665 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme involved in the first step of glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells that serves to anchor proteins to the cell surface. The encoded protein is a component of the GPI-N-acetylglucosaminyltransferase complex that catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc to phosphatidylinositol (PI). This gene is located in the Down Syndrome critical region on chromosome 21 and is a candidate for the pathogenesis of Down syndrome. This gene has multiple pseudogenes and is a member of the phosphatidylinositol glycan anchor biosynthesis gene family. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1l1 G A 6: 90,597,046 probably benign Het
Ambn T C 5: 88,467,951 V413A possibly damaging Het
Amotl1 T A 9: 14,596,528 D41V probably damaging Het
Arhgef26 T C 3: 62,340,047 V184A probably benign Het
Birc6 G T 17: 74,618,502 G936V possibly damaging Het
Ccser1 T A 6: 61,311,242 S130T possibly damaging Het
Cecr2 A G 6: 120,720,907 I56V probably damaging Het
Cfap52 A G 11: 67,930,744 I486T probably damaging Het
Col4a3 A G 1: 82,716,329 I1557V possibly damaging Het
Col6a5 T A 9: 105,945,847 I104F unknown Het
Cry2 A G 2: 92,412,967 S510P probably benign Het
Csmd2 G C 4: 128,546,151 A3133P probably benign Het
Cyld G T 8: 88,732,993 A611S probably damaging Het
Dennd4c G A 4: 86,825,512 G1197E probably damaging Het
Dnah10 T C 5: 124,808,729 F2969L probably benign Het
Dnaic1 A G 4: 41,625,281 K415R probably benign Het
Dnmbp T A 19: 43,854,171 T1253S probably benign Het
Dsp T C 13: 38,195,702 L1542P possibly damaging Het
Duox1 T A 2: 122,340,201 L1234Q probably damaging Het
Efr3b T A 12: 3,968,590 R585S possibly damaging Het
Gpt A G 15: 76,699,352 probably null Het
Heatr6 G A 11: 83,753,718 probably benign Het
Kcns2 A G 15: 34,839,784 D431G probably benign Het
Kdm3b A G 18: 34,829,289 N1543D probably damaging Het
Man2a1 A G 17: 64,625,380 K154R probably benign Het
Mical3 G A 6: 120,958,271 Q893* probably null Het
Morc3 C T 16: 93,866,453 H515Y possibly damaging Het
Mprip A T 11: 59,757,721 R750S probably damaging Het
Mroh1 G A 15: 76,451,491 V1436M probably benign Het
Muc5ac C T 7: 141,790,669 R69* probably null Het
Muc5b A T 7: 141,856,712 Y1274F unknown Het
Mybpc1 A G 10: 88,542,456 L674P probably damaging Het
Mypn A G 10: 63,131,023 V958A probably benign Het
Nipbl T C 15: 8,296,818 T2436A probably benign Het
Olfr835 A G 9: 19,035,147 D8G probably benign Het
Pcdhb5 T A 18: 37,321,773 L402Q probably damaging Het
Rp1 A G 1: 4,348,462 L809P probably benign Het
Scn3a T A 2: 65,494,781 probably benign Het
Sdf2 A T 11: 78,246,080 M29L probably benign Het
Serpina3b T G 12: 104,134,091 L311V possibly damaging Het
Snx31 A T 15: 36,523,488 Y349* probably null Het
Spidr A C 16: 16,114,869 C182W probably damaging Het
St13 A T 15: 81,377,798 S146R probably damaging Het
St8sia4 A G 1: 95,653,582 V145A probably damaging Het
Stradb T C 1: 58,980,016 probably null Het
Tcp11l2 T A 10: 84,594,797 probably benign Het
Tfdp2 C T 9: 96,317,574 P74S unknown Het
Tmprss15 C T 16: 79,057,659 R287H probably benign Het
Trav10d T C 14: 52,811,322 Y57H probably damaging Het
Vmn2r104 A G 17: 20,029,471 I846T probably benign Het
Ywhah T A 5: 33,026,948 M165K possibly damaging Het
Zfp324 C A 7: 12,969,366 P72T probably benign Het
Other mutations in Pigp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02100:Pigp APN 16 94364767 nonsense probably null
IGL02728:Pigp APN 16 94367607 missense probably damaging 1.00
schweinchen UTSW 16 94365441 missense probably damaging 1.00
R0092:Pigp UTSW 16 94365462 missense probably damaging 0.96
R3614:Pigp UTSW 16 94364724 missense possibly damaging 0.91
R4872:Pigp UTSW 16 94365450 missense probably benign 0.18
R4959:Pigp UTSW 16 94359147 missense probably benign 0.00
R4973:Pigp UTSW 16 94359147 missense probably benign 0.00
R6135:Pigp UTSW 16 94370206 missense probably benign 0.20
R6179:Pigp UTSW 16 94370367 missense probably null 0.99
R6732:Pigp UTSW 16 94365441 missense probably damaging 1.00
R7576:Pigp UTSW 16 94370405 missense probably benign 0.40
Z1177:Pigp UTSW 16 94370695 intron probably benign
Predicted Primers PCR Primer
(F):5'- GTGTACGTTCTAAGGACAAACAC -3'
(R):5'- ATCATGAGAGGGCAGGACTC -3'

Sequencing Primer
(F):5'- GGACAAACACATTATTTCCTGGTTC -3'
(R):5'- TCAGAGGGTCCGAGGTG -3'
Posted On2017-03-31