Mutagenetix > Incidental Mutation

Incidental Mutation 'R5971:Pik3c2b'

470837

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

044154-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R5971 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

splice site (5 bp from exon)

DNA Base Change (assembly)

G to A at 133074627 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730] [ENSMUST00000077730] [ENSMUST00000077730] [ENSMUST00000077730]

AlphaFold

E9QAN8

Predicted Effect

probably null
Transcript: ENSMUST00000077730

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000077730

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000077730

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000077730

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124934

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

87% (27/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
5031439G07Rik	G	T	15: 84,987,662	A4D	possibly damaging	Het
6820408C15Rik	T	C	2: 152,440,870	V215A	probably damaging	Het
Abcc9	A	G	6: 142,639,575	F801S	probably damaging	Het
Abhd14a	A	T	9: 106,443,866	S97T	possibly damaging	Het
Adam39	C	T	8: 40,824,593	A7V	probably benign	Het
Anxa10	C	A	8: 62,077,926	M83I	probably benign	Het
Ctnna1	T	C	18: 35,154,514	V92A	probably benign	Het
Gcg	A	G	2: 62,475,804	S150P	probably damaging	Het
Kitl	G	A	10: 100,076,906		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Msl1	G	T	11: 98,798,693	G9C	probably benign	Het
Myo3b	T	C	2: 70,238,899	V494A	possibly damaging	Het
Olfr356	G	A	2: 36,937,229	V37I	probably benign	Het
Plagl1	G	A	10: 13,127,746	G253R	probably damaging	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ppp4r1	G	A	17: 65,814,348	V268I	possibly damaging	Het
Slc13a1	T	C	6: 24,133,657	T199A	probably benign	Het
Theg	A	G	10: 79,584,755	S159P	probably damaging	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4948:Pik3c2b	UTSW	1	133099715	critical splice donor site	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTGAAGCACCCATCCTTC -3'
(R):5'- TGACTGGCCTCTCTTGGAGATG -3'

Sequencing Primer
(F):5'- CCTCCCACTGAGTCCCTAAGG -3'
(R):5'- TAGTTCAAGGTGGAAGGGCTC -3'

Posted On

2017-03-31