Incidental Mutation 'R5971:Pik3c2b'
ID 470837
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms PI3K-C2beta, C330011J12Rik
MMRRC Submission 044154-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R5971 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 132973410-133036429 bp(+) (GRCm39)
Type of Mutation splice site (5 bp from exon)
DNA Base Change (assembly) G to A at 133002365 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730] [ENSMUST00000077730] [ENSMUST00000077730] [ENSMUST00000077730]
AlphaFold E9QAN8
Predicted Effect probably null
Transcript: ENSMUST00000077730
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000077730
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000077730
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Predicted Effect probably null
Transcript: ENSMUST00000077730
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124934
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 87% (27/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,684,980 (GRCm39) C172* probably null Het
5031439G07Rik G T 15: 84,871,863 (GRCm39) A4D possibly damaging Het
6820408C15Rik T C 2: 152,282,790 (GRCm39) V215A probably damaging Het
Abcc9 A G 6: 142,585,301 (GRCm39) F801S probably damaging Het
Abhd14a A T 9: 106,321,065 (GRCm39) S97T possibly damaging Het
Adam39 C T 8: 41,277,630 (GRCm39) A7V probably benign Het
Anxa10 C A 8: 62,530,960 (GRCm39) M83I probably benign Het
Ctnna1 T C 18: 35,287,567 (GRCm39) V92A probably benign Het
Gcg A G 2: 62,306,148 (GRCm39) S150P probably damaging Het
Kitl G A 10: 99,912,768 (GRCm39) probably null Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Msl1 G T 11: 98,689,519 (GRCm39) G9C probably benign Het
Myo3b T C 2: 70,069,243 (GRCm39) V494A possibly damaging Het
Or1ak2 G A 2: 36,827,241 (GRCm39) V37I probably benign Het
Plagl1 G A 10: 13,003,490 (GRCm39) G253R probably damaging Het
Polr1c G T 17: 46,558,635 (GRCm39) probably benign Het
Ppp4r1 G A 17: 66,121,343 (GRCm39) V268I possibly damaging Het
Slc13a1 T C 6: 24,133,656 (GRCm39) T199A probably benign Het
Spmap2 A G 10: 79,420,589 (GRCm39) S159P probably damaging Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133,019,356 (GRCm39) missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133,022,543 (GRCm39) missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 132,999,369 (GRCm39) nonsense probably null
IGL01367:Pik3c2b APN 1 133,033,726 (GRCm39) missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133,022,529 (GRCm39) missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133,005,056 (GRCm39) splice site probably benign
IGL02728:Pik3c2b APN 1 133,020,065 (GRCm39) missense probably benign 0.09
IGL02992:Pik3c2b APN 1 132,994,718 (GRCm39) nonsense probably null
IGL03121:Pik3c2b APN 1 133,007,483 (GRCm39) missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133,005,134 (GRCm39) missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133,033,730 (GRCm39) missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133,028,569 (GRCm39) missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 132,998,938 (GRCm39) missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133,017,772 (GRCm39) missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133,022,564 (GRCm39) missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1729:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1730:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1739:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1762:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1783:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1784:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1785:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133,029,108 (GRCm39) missense probably benign 0.00
R1897:Pik3c2b UTSW 1 132,994,654 (GRCm39) missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 132,994,282 (GRCm39) missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133,027,349 (GRCm39) missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133,031,166 (GRCm39) missense probably benign
R2294:Pik3c2b UTSW 1 132,994,513 (GRCm39) missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133,031,151 (GRCm39) missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 132,994,787 (GRCm39) missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133,027,364 (GRCm39) nonsense probably null
R4948:Pik3c2b UTSW 1 133,027,453 (GRCm39) critical splice donor site probably null
R4997:Pik3c2b UTSW 1 133,032,819 (GRCm39) missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 132,998,146 (GRCm39) missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133,027,440 (GRCm39) missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133,031,574 (GRCm39) missense probably damaging 1.00
R5980:Pik3c2b UTSW 1 133,016,046 (GRCm39) missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133,018,451 (GRCm39) missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R6223:Pik3c2b UTSW 1 132,998,095 (GRCm39) missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 132,994,449 (GRCm39) missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133,003,559 (GRCm39) missense probably benign
R6954:Pik3c2b UTSW 1 132,994,041 (GRCm39) missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133,030,110 (GRCm39) missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133,033,712 (GRCm39) missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133,017,972 (GRCm39) missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133,033,850 (GRCm39) missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 132,994,203 (GRCm39) missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133,007,512 (GRCm39) missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133,022,472 (GRCm39) missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133,017,940 (GRCm39) missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133,018,444 (GRCm39) missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133,007,579 (GRCm39) critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133,013,349 (GRCm39) missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133,030,043 (GRCm39) missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 132,998,980 (GRCm39) missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133,017,799 (GRCm39) critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133,028,642 (GRCm39) missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133,031,587 (GRCm39) missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133,003,547 (GRCm39) critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133,017,984 (GRCm39) missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133,016,068 (GRCm39) missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133,018,517 (GRCm39) missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133,005,187 (GRCm39) missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133,012,725 (GRCm39) critical splice donor site probably null
R9621:Pik3c2b UTSW 1 132,999,345 (GRCm39) missense probably damaging 1.00
R9742:Pik3c2b UTSW 1 133,022,487 (GRCm39) missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133,018,588 (GRCm39) missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133,019,338 (GRCm39) missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
X0060:Pik3c2b UTSW 1 133,012,674 (GRCm39) missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133,027,424 (GRCm39) nonsense probably null
Z1176:Pik3c2b UTSW 1 132,994,291 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGAAGCACCCATCCTTC -3'
(R):5'- TGACTGGCCTCTCTTGGAGATG -3'

Sequencing Primer
(F):5'- CCTCCCACTGAGTCCCTAAGG -3'
(R):5'- TAGTTCAAGGTGGAAGGGCTC -3'
Posted On 2017-03-31