Mutagenetix > Incidental Mutation

Incidental Mutation 'R5971:Myo3b'

470841

Institutional Source

Beutler Lab

Gene Symbol

Myo3b

Ensembl Gene

ENSMUSG00000042064

Gene Name

myosin IIIB

Synonyms

A430065P19Rik

MMRRC Submission

044154-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5971 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70039126-70429198 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70238899 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 494 (V494A)

Ref Sequence

ENSEMBL: ENSMUSP00000107862 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]

AlphaFold

Q1EG27

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060208
AA Change: V522A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: V522A

Domain	Start	End	E-Value	Type
S_TKc	43	309	2.24e-85	SMART
MYSc	353	1075	6.61e-260	SMART
IQ	1075	1097	9.51e1	SMART
IQ	1102	1124	1.73e-5	SMART
low complexity region	1319	1324	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112243
AA Change: V494A

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: V494A

Domain	Start	End	E-Value	Type
S_TKc	15	281	2.24e-85	SMART
MYSc	325	1047	6.61e-260	SMART
IQ	1047	1069	9.51e1	SMART
IQ	1074	1096	1.73e-5	SMART
low complexity region	1291	1296	N/A	INTRINSIC

Meta Mutation Damage Score

0.4164

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.0%

Validation Efficiency

87% (27/31)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
5031439G07Rik	G	T	15: 84,987,662	A4D	possibly damaging	Het
6820408C15Rik	T	C	2: 152,440,870	V215A	probably damaging	Het
Abcc9	A	G	6: 142,639,575	F801S	probably damaging	Het
Abhd14a	A	T	9: 106,443,866	S97T	possibly damaging	Het
Adam39	C	T	8: 40,824,593	A7V	probably benign	Het
Anxa10	C	A	8: 62,077,926	M83I	probably benign	Het
Ctnna1	T	C	18: 35,154,514	V92A	probably benign	Het
Gcg	A	G	2: 62,475,804	S150P	probably damaging	Het
Kitl	G	A	10: 100,076,906		probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Msl1	G	T	11: 98,798,693	G9C	probably benign	Het
Olfr356	G	A	2: 36,937,229	V37I	probably benign	Het
Pik3c2b	G	A	1: 133,074,627		probably null	Het
Plagl1	G	A	10: 13,127,746	G253R	probably damaging	Het
Polr1c	G	T	17: 46,247,709		probably benign	Het
Ppp4r1	G	A	17: 65,814,348	V268I	possibly damaging	Het
Slc13a1	T	C	6: 24,133,657	T199A	probably benign	Het
Theg	A	G	10: 79,584,755	S159P	probably damaging	Het

Other mutations in Myo3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00736:Myo3b	APN	2	70105645	splice site	probably benign
IGL00959:Myo3b	APN	2	70314292	missense	probably damaging	1.00
IGL01069:Myo3b	APN	2	70245391	missense	probably benign	0.22
IGL01116:Myo3b	APN	2	70289386	missense	probably damaging	1.00
IGL02097:Myo3b	APN	2	70238829	missense	probably damaging	1.00
IGL02220:Myo3b	APN	2	70289579	splice site	probably benign
IGL02553:Myo3b	APN	2	70095224	missense	probably benign	0.00
IGL02557:Myo3b	APN	2	70255319	missense	probably benign	0.16
IGL02648:Myo3b	APN	2	70105372	splice site	probably benign
IGL02902:Myo3b	APN	2	70289401	missense	probably benign	0.36
IGL02981:Myo3b	APN	2	70108625	missense	probably damaging	1.00
IGL03030:Myo3b	APN	2	70426816	splice site	probably benign
IGL03031:Myo3b	APN	2	70255377	missense	possibly damaging	0.64
IGL03068:Myo3b	APN	2	70426816	splice site	probably benign
IGL03078:Myo3b	APN	2	70286991	missense	probably damaging	1.00
IGL03224:Myo3b	APN	2	70349939	missense	probably benign
IGL03329:Myo3b	APN	2	70254459	missense	probably damaging	1.00
R0079:Myo3b	UTSW	2	70095158	missense	possibly damaging	0.58
R0226:Myo3b	UTSW	2	70217166	missense	probably benign	0.00
R0238:Myo3b	UTSW	2	70105425	missense	probably benign	0.00
R0238:Myo3b	UTSW	2	70105425	missense	probably benign	0.00
R0239:Myo3b	UTSW	2	70105425	missense	probably benign	0.00
R0239:Myo3b	UTSW	2	70105425	missense	probably benign	0.00
R0313:Myo3b	UTSW	2	70348959	nonsense	probably null
R0331:Myo3b	UTSW	2	70095261	missense	probably damaging	1.00
R0371:Myo3b	UTSW	2	70252960	splice site	probably benign
R0442:Myo3b	UTSW	2	70238961	critical splice donor site	probably null
R0964:Myo3b	UTSW	2	70426849	missense	probably damaging	1.00
R1217:Myo3b	UTSW	2	70330880	missense	probably benign	0.02
R1429:Myo3b	UTSW	2	70253007	missense	probably damaging	0.97
R1460:Myo3b	UTSW	2	70232454	missense	probably benign	0.31
R1617:Myo3b	UTSW	2	70281218	missense	probably benign	0.00
R1628:Myo3b	UTSW	2	70286962	missense	probably benign	0.01
R1708:Myo3b	UTSW	2	70245385	nonsense	probably null
R1940:Myo3b	UTSW	2	70258075	missense	probably benign	0.01
R2407:Myo3b	UTSW	2	70255253	missense	probably damaging	1.00
R3081:Myo3b	UTSW	2	70256583	splice site	probably benign
R3687:Myo3b	UTSW	2	70245314	missense	probably benign
R3745:Myo3b	UTSW	2	70234485	splice site	probably benign
R4011:Myo3b	UTSW	2	70096376	missense	probably benign	0.15
R4074:Myo3b	UTSW	2	70289464	missense	probably damaging	1.00
R4419:Myo3b	UTSW	2	70096362	missense	probably damaging	1.00
R4496:Myo3b	UTSW	2	70254404	missense	probably benign
R4539:Myo3b	UTSW	2	70039147	start codon destroyed	probably null	0.00
R4643:Myo3b	UTSW	2	70238842	missense	possibly damaging	0.49
R4657:Myo3b	UTSW	2	70238899	missense	possibly damaging	0.95
R4807:Myo3b	UTSW	2	70105712	missense	probably damaging	1.00
R4849:Myo3b	UTSW	2	70244909	missense	probably damaging	0.98
R4997:Myo3b	UTSW	2	70258083	missense	possibly damaging	0.49
R5008:Myo3b	UTSW	2	70258068	missense	probably damaging	0.99
R5070:Myo3b	UTSW	2	70253112	missense	probably damaging	1.00
R5072:Myo3b	UTSW	2	70095249	missense	possibly damaging	0.96
R5082:Myo3b	UTSW	2	70258030	missense	probably benign	0.01
R5103:Myo3b	UTSW	2	70096403	missense	probably benign	0.08
R5109:Myo3b	UTSW	2	70095293	missense	possibly damaging	0.66
R5304:Myo3b	UTSW	2	70426888	missense	probably damaging	0.97
R5396:Myo3b	UTSW	2	70126985	missense	probably damaging	0.99
R5400:Myo3b	UTSW	2	70105380	missense	probably damaging	1.00
R5468:Myo3b	UTSW	2	70234441	missense	probably benign	0.00
R5620:Myo3b	UTSW	2	70238910	missense	probably benign	0.04
R5646:Myo3b	UTSW	2	70314430	missense	probably damaging	0.97
R5729:Myo3b	UTSW	2	70105739	missense	probably damaging	1.00
R5943:Myo3b	UTSW	2	70286941	missense	probably benign	0.03
R6091:Myo3b	UTSW	2	70238769	missense	probably benign	0.00
R6138:Myo3b	UTSW	2	70238899	missense	possibly damaging	0.95
R6164:Myo3b	UTSW	2	70245410	critical splice donor site	probably null
R6177:Myo3b	UTSW	2	70313363	missense	probably benign	0.00
R6421:Myo3b	UTSW	2	70313356	missense	probably benign	0.02
R6478:Myo3b	UTSW	2	70348960	missense	probably benign
R6606:Myo3b	UTSW	2	70232485	missense	possibly damaging	0.94
R6752:Myo3b	UTSW	2	70289512	missense	probably damaging	1.00
R6982:Myo3b	UTSW	2	70426065	missense	probably benign	0.02
R6997:Myo3b	UTSW	2	70126985	missense	probably damaging	0.99
R7032:Myo3b	UTSW	2	70095264	missense	probably damaging	0.98
R7038:Myo3b	UTSW	2	70095208	missense	probably benign	0.00
R7062:Myo3b	UTSW	2	70217157	missense	probably benign	0.00
R7537:Myo3b	UTSW	2	70217169	missense	probably benign	0.01
R7861:Myo3b	UTSW	2	70108688	missense	probably damaging	1.00
R7955:Myo3b	UTSW	2	70095279	missense	probably benign	0.37
R7977:Myo3b	UTSW	2	70330933	missense	probably benign
R7978:Myo3b	UTSW	2	70253114	missense	probably damaging	1.00
R7987:Myo3b	UTSW	2	70330933	missense	probably benign
R8803:Myo3b	UTSW	2	70252994	missense	probably benign
R8843:Myo3b	UTSW	2	70257981	missense	probably damaging	1.00
R8896:Myo3b	UTSW	2	70238816	missense	probably damaging	1.00
R8904:Myo3b	UTSW	2	70426908	missense	probably benign	0.07
R8909:Myo3b	UTSW	2	70253096	missense	probably damaging	1.00
R9031:Myo3b	UTSW	2	70251750	missense	probably damaging	0.99
R9052:Myo3b	UTSW	2	70232403	missense	probably benign	0.00
R9251:Myo3b	UTSW	2	70258081	nonsense	probably null
R9268:Myo3b	UTSW	2	70426961	makesense	probably null
R9334:Myo3b	UTSW	2	70217016	missense	probably damaging	1.00
R9377:Myo3b	UTSW	2	70238898	missense	possibly damaging	0.78
R9457:Myo3b	UTSW	2	70095209	missense	probably benign	0.01
R9520:Myo3b	UTSW	2	70232409	missense	possibly damaging	0.67
R9593:Myo3b	UTSW	2	70245304	missense	probably benign	0.43
R9671:Myo3b	UTSW	2	70256564	missense	probably damaging	1.00
R9790:Myo3b	UTSW	2	70349943	missense	probably benign	0.35
R9791:Myo3b	UTSW	2	70349943	missense	probably benign	0.35
U15987:Myo3b	UTSW	2	70238899	missense	possibly damaging	0.95
X0025:Myo3b	UTSW	2	70232403	missense	probably benign	0.00
X0065:Myo3b	UTSW	2	70257969	missense	probably damaging	1.00
Z1177:Myo3b	UTSW	2	70096361	missense	probably damaging	1.00
Z1177:Myo3b	UTSW	2	70258027	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCAGGGCAGCATCATTGGAG -3'
(R):5'- AAATCAGCTACCACTGCTCCTTTG -3'

Sequencing Primer
(F):5'- ATCATTGGAGTGCGGCCTC -3'
(R):5'- CTGCCTGCTGTATAACTC -3'

Posted On

2017-03-31