Incidental Mutation 'R5971:6820408C15Rik'
ID470842
Institutional Source Beutler Lab
Gene Symbol 6820408C15Rik
Ensembl Gene ENSMUSG00000032680
Gene NameRIKEN cDNA 6820408C15 gene
Synonyms
MMRRC Submission 044154-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5971 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152415587-152444330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 152440870 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 215 (V215A)
Ref Sequence ENSEMBL: ENSMUSP00000037024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039961] [ENSMUST00000128737] [ENSMUST00000153713]
Predicted Effect probably damaging
Transcript: ENSMUST00000039961
AA Change: V215A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037024
Gene: ENSMUSG00000032680
AA Change: V215A

DomainStartEndE-ValueType
Pfam:DUF4618 96 353 4.1e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128737
SMART Domains Protein: ENSMUSP00000117627
Gene: ENSMUSG00000032680

DomainStartEndE-ValueType
Pfam:DUF4618 97 158 1.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153713
SMART Domains Protein: ENSMUSP00000120724
Gene: ENSMUSG00000032680

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Meta Mutation Damage Score 0.3694 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.0%
Validation Efficiency 87% (27/31)
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
5031439G07Rik G T 15: 84,987,662 A4D possibly damaging Het
Abcc9 A G 6: 142,639,575 F801S probably damaging Het
Abhd14a A T 9: 106,443,866 S97T possibly damaging Het
Adam39 C T 8: 40,824,593 A7V probably benign Het
Anxa10 C A 8: 62,077,926 M83I probably benign Het
Ctnna1 T C 18: 35,154,514 V92A probably benign Het
Gcg A G 2: 62,475,804 S150P probably damaging Het
Kitl G A 10: 100,076,906 probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Msl1 G T 11: 98,798,693 G9C probably benign Het
Myo3b T C 2: 70,238,899 V494A possibly damaging Het
Olfr356 G A 2: 36,937,229 V37I probably benign Het
Pik3c2b G A 1: 133,074,627 probably null Het
Plagl1 G A 10: 13,127,746 G253R probably damaging Het
Polr1c G T 17: 46,247,709 probably benign Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Slc13a1 T C 6: 24,133,657 T199A probably benign Het
Theg A G 10: 79,584,755 S159P probably damaging Het
Other mutations in 6820408C15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:6820408C15Rik APN 2 152442387 missense possibly damaging 0.89
IGL01986:6820408C15Rik APN 2 152441036 missense possibly damaging 0.84
IGL02153:6820408C15Rik APN 2 152441241 missense probably benign 0.06
IGL02178:6820408C15Rik APN 2 152428001 splice site probably benign
IGL03339:6820408C15Rik APN 2 152442456 missense probably damaging 1.00
R0468:6820408C15Rik UTSW 2 152441266 missense probably benign 0.01
R1624:6820408C15Rik UTSW 2 152434111 missense probably damaging 0.98
R1642:6820408C15Rik UTSW 2 152440854 missense probably damaging 1.00
R2420:6820408C15Rik UTSW 2 152429001 missense probably damaging 1.00
R3109:6820408C15Rik UTSW 2 152442456 missense probably damaging 1.00
R3153:6820408C15Rik UTSW 2 152440824 missense probably damaging 1.00
R3154:6820408C15Rik UTSW 2 152440824 missense probably damaging 1.00
R3875:6820408C15Rik UTSW 2 152434080 missense probably benign
R4237:6820408C15Rik UTSW 2 152428953 missense possibly damaging 0.46
R4746:6820408C15Rik UTSW 2 152440765 missense probably benign 0.13
R4957:6820408C15Rik UTSW 2 152444093 missense probably damaging 1.00
R4959:6820408C15Rik UTSW 2 152440888 missense possibly damaging 0.90
R4973:6820408C15Rik UTSW 2 152440888 missense possibly damaging 0.90
R5261:6820408C15Rik UTSW 2 152440857 missense probably damaging 1.00
R5399:6820408C15Rik UTSW 2 152440868 missense probably damaging 1.00
R6138:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
R6223:6820408C15Rik UTSW 2 152427953 missense probably benign 0.00
R6379:6820408C15Rik UTSW 2 152427992 missense probably benign 0.01
R6642:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
R6815:6820408C15Rik UTSW 2 152441055 missense probably benign 0.29
R8083:6820408C15Rik UTSW 2 152441067 missense possibly damaging 0.94
U15987:6820408C15Rik UTSW 2 152440870 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTGAAAGAAGCCCCAGAC -3'
(R):5'- ACCAGAGACTTCAGGATTTTCTTC -3'

Sequencing Primer
(F):5'- TCTGAAAGAAGCCCCAGACATCTG -3'
(R):5'- GAGACTTCAGGATTTTCTTCTTCTTC -3'
Posted On2017-03-31