Mutagenetix > Incidental Mutations

Incidental Mutation 'R5951:Ubap2'

470870

Institutional Source

Beutler Lab

Gene Symbol

Ubap2

Ensembl Gene

ENSMUSG00000028433

Gene Name

ubiquitin-associated protein 2

Synonyms

1190005K07Rik

MMRRC Submission

044141-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R5951 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41194313-41275144 bp(-) (GRCm38)

Type of Mutation

unclassified (1142 bp from exon)

DNA Base Change (assembly)

A to T at 41205753 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000122256 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030143] [ENSMUST00000108068] [ENSMUST00000135323]

Predicted Effect

probably null
Transcript: ENSMUST00000030143

SMART Domains

Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433

Domain	Start	End	E-Value	Type
UBA	53	91	9.62e-8	SMART
low complexity region	115	127	N/A	INTRINSIC
low complexity region	130	144	N/A	INTRINSIC
low complexity region	166	185	N/A	INTRINSIC
low complexity region	256	266	N/A	INTRINSIC
low complexity region	341	358	N/A	INTRINSIC
low complexity region	436	448	N/A	INTRINSIC
Pfam:DUF3697	512	544	1.5e-18	PFAM
low complexity region	583	618	N/A	INTRINSIC
low complexity region	631	644	N/A	INTRINSIC
low complexity region	696	722	N/A	INTRINSIC
low complexity region	744	768	N/A	INTRINSIC
low complexity region	787	800	N/A	INTRINSIC
low complexity region	888	914	N/A	INTRINSIC
low complexity region	1007	1024	N/A	INTRINSIC
low complexity region	1057	1078	N/A	INTRINSIC
low complexity region	1084	1098	N/A	INTRINSIC
low complexity region	1101	1115	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000108068

SMART Domains

Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433

Domain	Start	End	E-Value	Type
UBA	52	90	9.62e-8	SMART
low complexity region	114	126	N/A	INTRINSIC
low complexity region	129	143	N/A	INTRINSIC
low complexity region	165	184	N/A	INTRINSIC
low complexity region	255	265	N/A	INTRINSIC
low complexity region	340	357	N/A	INTRINSIC
low complexity region	435	447	N/A	INTRINSIC
Pfam:DUF3697	511	543	1.2e-20	PFAM
low complexity region	582	617	N/A	INTRINSIC
low complexity region	630	643	N/A	INTRINSIC
low complexity region	695	721	N/A	INTRINSIC
low complexity region	743	767	N/A	INTRINSIC
low complexity region	786	799	N/A	INTRINSIC
low complexity region	887	913	N/A	INTRINSIC
low complexity region	1006	1023	N/A	INTRINSIC
low complexity region	1056	1077	N/A	INTRINSIC
low complexity region	1083	1097	N/A	INTRINSIC
low complexity region	1100	1114	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000135323

SMART Domains

Protein: ENSMUSP00000122256
Gene: ENSMUSG00000028433

Domain	Start	End	E-Value	Type
low complexity region	74	91	N/A	INTRINSIC
low complexity region	169	181	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158640

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	A	2: 35,354,799	E180D	probably damaging	Het
Add3	A	G	19: 53,244,289		probably null	Het
Adgrv1	A	T	13: 81,442,501	I4396N	probably damaging	Het
Apc	C	T	18: 34,317,146	S2331L	possibly damaging	Het
Apoh	G	T	11: 108,395,903	C51F	probably damaging	Het
Arid4b	T	C	13: 14,143,063	V177A	possibly damaging	Het
Atp13a1	T	A	8: 69,797,285	I343N	probably damaging	Het
Bcar1	T	C	8: 111,713,400	D654G	probably benign	Het
Brox	T	C	1: 183,282,508	K245R	probably damaging	Het
Ccdc146	A	T	5: 21,319,579	S258R	possibly damaging	Het
Ccdc169	A	C	3: 55,140,141	K18Q	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Crot	C	A	5: 8,969,120	E478*	probably null	Het
Dgkq	A	T	5: 108,654,370	M443K	probably damaging	Het
Dhx32	A	T	7: 133,737,328	L326Q	probably damaging	Het
Dtwd1	A	G	2: 126,158,422	I93V	probably benign	Het
Ehmt2	C	T	17: 34,899,381	T44I	probably benign	Het
Enc1	T	C	13: 97,245,257	S92P	probably benign	Het
Epha5	T	C	5: 84,331,192		probably benign	Het
Eya4	T	A	10: 23,155,994	S244C	probably damaging	Het
Fmnl3	G	A	15: 99,325,910	R302W	probably damaging	Het
Fscn3	A	T	6: 28,436,174	I490F	possibly damaging	Het
Galntl6	A	G	8: 57,962,402	V239A	probably benign	Het
Glg1	T	C	8: 111,165,691	I841V	possibly damaging	Het
Gm15455	T	C	1: 33,837,812		noncoding transcript	Het
Gpd1l	C	T	9: 114,914,405	M142I	probably benign	Het
Helb	A	G	10: 120,091,748	V819A	possibly damaging	Het
Hnrnpul2	T	G	19: 8,824,891	F374C	probably damaging	Het
Hoxc10	G	A	15: 102,967,318	S154N	possibly damaging	Het
Ice2	A	T	9: 69,412,369	T367S	possibly damaging	Het
Iqca	A	T	1: 90,140,097		probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Klhl14	T	A	18: 21,651,620	H250L	probably damaging	Het
Kmt2c	A	T	5: 25,330,803	D1447E	probably benign	Het
Larp1	G	T	11: 58,049,939	M630I	probably benign	Het
Lrp2	A	G	2: 69,496,323		probably null	Het
Map4k3	G	T	17: 80,603,998	Q673K	probably benign	Het
Mettl16	A	G	11: 74,795,997	N201D	possibly damaging	Het
Mrpl15	C	A	1: 4,785,733		probably benign	Het
Mthfd1l	T	A	10: 4,048,222	V655D	probably damaging	Het
Odf1	T	C	15: 38,226,287	Y144H	probably damaging	Het
Olfr1093	G	T	2: 86,786,227	V166L	probably benign	Het
Olfr38	G	T	6: 42,762,559	C169F	probably damaging	Het
Padi1	T	C	4: 140,814,829	Y594C	probably damaging	Het
Palm3	T	A	8: 84,029,420	D520E	probably benign	Het
Paox	G	A	7: 140,127,654	C130Y	probably damaging	Het
Parpbp	T	A	10: 88,139,907	S115C	probably damaging	Het
Pcnx3	A	G	19: 5,671,680	V1438A	possibly damaging	Het
Pdlim2	T	A	14: 70,167,780	D212V	probably benign	Het
Pi4ka	A	G	16: 17,303,142	F53L	probably damaging	Het
Pik3c2a	A	T	7: 116,368,184	D839E	probably damaging	Het
Pou2f1	T	C	1: 165,883,056		probably benign	Het
Ppl	A	T	16: 5,088,628	Y1268N	probably benign	Het
Prelid3a	C	T	18: 67,464,941	S6L	probably benign	Het
Ptk2	T	G	15: 73,303,833	D285A	possibly damaging	Het
Rasd2	T	G	8: 75,222,183	Y246D	probably damaging	Het
Rhbdl2	A	G	4: 123,814,327	T110A	probably benign	Het
Rhobtb1	T	A	10: 69,270,255	F217I	probably damaging	Het
Serhl	T	C	15: 83,103,036		probably benign	Het
Sh3tc2	A	G	18: 61,990,007	E613G	probably damaging	Het
Slc26a3	A	G	12: 31,452,715		probably benign	Het
Steap4	T	C	5: 7,975,769	I110T	probably benign	Het
Syde1	C	A	10: 78,589,316	R287L	possibly damaging	Het
Tmem184c	C	T	8: 77,598,662		probably null	Het
Trmt44	C	A	5: 35,572,688		probably benign	Het
Ttbk2	G	T	2: 120,773,283	S256R	probably benign	Het
Ttll6	A	T	11: 96,145,510	I322F	probably damaging	Het
Wsb2	A	T	5: 117,377,535	T402S	probably damaging	Het

Other mutations in Ubap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Ubap2	APN	4	41195328	splice site	probably benign
IGL01109:Ubap2	APN	4	41195155	missense	probably damaging	1.00
IGL01354:Ubap2	APN	4	41207005	missense	probably damaging	1.00
IGL01563:Ubap2	APN	4	41195998	missense	probably damaging	0.96
IGL01602:Ubap2	APN	4	41227237	missense	probably damaging	1.00
IGL01605:Ubap2	APN	4	41227237	missense	probably damaging	1.00
IGL01688:Ubap2	APN	4	41226308	missense	probably benign
IGL01733:Ubap2	APN	4	41195862	unclassified	probably benign
IGL01896:Ubap2	APN	4	41202362	missense	possibly damaging	0.85
IGL01942:Ubap2	APN	4	41251608	missense	probably benign	0.00
IGL02095:Ubap2	APN	4	41229709	missense	probably benign
R0608:Ubap2	UTSW	4	41218319	missense	probably benign	0.10
R0938:Ubap2	UTSW	4	41202304	missense	probably damaging	1.00
R1449:Ubap2	UTSW	4	41209351	critical splice donor site	probably null
R1484:Ubap2	UTSW	4	41235593	missense	probably damaging	1.00
R1548:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1549:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1604:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1607:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1739:Ubap2	UTSW	4	41206849	missense	probably benign	0.00
R1772:Ubap2	UTSW	4	41202380	missense	probably benign	0.02
R1862:Ubap2	UTSW	4	41221607	missense	probably benign
R1869:Ubap2	UTSW	4	41233617	missense	probably damaging	1.00
R1886:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1887:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2063:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2064:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2065:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2066:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2095:Ubap2	UTSW	4	41206901	missense	possibly damaging	0.68
R2214:Ubap2	UTSW	4	41199714	critical splice donor site	probably null
R2215:Ubap2	UTSW	4	41196483	unclassified	probably null
R2318:Ubap2	UTSW	4	41251542	missense	probably damaging	0.99
R3755:Ubap2	UTSW	4	41195482	missense	probably damaging	1.00
R4620:Ubap2	UTSW	4	41233698	missense	probably damaging	1.00
R4717:Ubap2	UTSW	4	41218333	missense	possibly damaging	0.93
R4756:Ubap2	UTSW	4	41211771	missense	probably damaging	1.00
R4942:Ubap2	UTSW	4	41245461	intron	probably benign
R5344:Ubap2	UTSW	4	41251578	missense	possibly damaging	0.46
R5763:Ubap2	UTSW	4	41195809	missense	probably damaging	1.00
R5851:Ubap2	UTSW	4	41206268	nonsense	probably null
R6178:Ubap2	UTSW	4	41206981	missense	probably benign
R6489:Ubap2	UTSW	4	41203574	critical splice acceptor site	probably null
R6520:Ubap2	UTSW	4	41195155	missense	probably damaging	1.00
R6652:Ubap2	UTSW	4	41196743	missense	possibly damaging	0.68
R6702:Ubap2	UTSW	4	41227210	small insertion	probably benign
R6736:Ubap2	UTSW	4	41227210	small insertion	probably benign
R6736:Ubap2	UTSW	4	41227224	small insertion	probably benign
R6860:Ubap2	UTSW	4	41233631	missense	probably damaging	1.00
R7007:Ubap2	UTSW	4	41206221	missense	probably damaging	0.97
R7048:Ubap2	UTSW	4	41196033	missense	possibly damaging	0.49
R7121:Ubap2	UTSW	4	41205550	missense	probably benign	0.00
R7371:Ubap2	UTSW	4	41195779	missense	probably benign	0.16
R7378:Ubap2	UTSW	4	41235515	critical splice donor site	probably null
R7695:Ubap2	UTSW	4	41211740	missense	probably damaging	0.98
R7811:Ubap2	UTSW	4	41211710	missense	probably benign	0.22
R7828:Ubap2	UTSW	4	41221615	missense	probably benign	0.00
R7838:Ubap2	UTSW	4	41233655	missense	probably damaging	1.00
R7921:Ubap2	UTSW	4	41233655	missense	probably damaging	1.00
R8016:Ubap2	UTSW	4	41195201	missense	possibly damaging	0.91
X0061:Ubap2	UTSW	4	41196507	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAATCCTGGTATGCACAG -3'
(R):5'- ACCCTCTGACAAAGTATGTGTC -3'

Sequencing Primer
(F):5'- ATCCTGGTATGCACAGAACTC -3'
(R):5'- AACTCTGAGCTGGACATGTC -3'

Posted On

2017-03-31