Incidental Mutation 'R5951:Trmt44'
ID 470879
Institutional Source Beutler Lab
Gene Symbol Trmt44
Ensembl Gene ENSMUSG00000029097
Gene Name tRNA methyltransferase 44
Synonyms 2310079F23Rik
MMRRC Submission 044141-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.111) question?
Stock # R5951 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 35713547-35732414 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) C to A at 35730032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030980]
AlphaFold Q9D2Q2
Predicted Effect probably benign
Transcript: ENSMUST00000030980
SMART Domains Protein: ENSMUSP00000030980
Gene: ENSMUSG00000029097

DomainStartEndE-ValueType
Pfam:AdoMet_MTase 252 363 3.1e-42 PFAM
low complexity region 524 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145930
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative tRNA methyltransferase found in the cytoplasm. Defects in this gene may be a cause of partial epilepsy with pericentral spikes (PEPS), but that has not been proven definitively. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,244,811 (GRCm39) E180D probably damaging Het
Add3 A G 19: 53,232,720 (GRCm39) probably null Het
Adgrv1 A T 13: 81,590,620 (GRCm39) I4396N probably damaging Het
Apc C T 18: 34,450,199 (GRCm39) S2331L possibly damaging Het
Apoh G T 11: 108,286,729 (GRCm39) C51F probably damaging Het
Arid4b T C 13: 14,317,648 (GRCm39) V177A possibly damaging Het
Atp13a1 T A 8: 70,249,935 (GRCm39) I343N probably damaging Het
Bcar1 T C 8: 112,440,032 (GRCm39) D654G probably benign Het
Brox T C 1: 183,064,072 (GRCm39) K245R probably damaging Het
Ccdc146 A T 5: 21,524,577 (GRCm39) S258R possibly damaging Het
Ccdc169 A C 3: 55,047,562 (GRCm39) K18Q probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Crot C A 5: 9,019,120 (GRCm39) E478* probably null Het
Dgkq A T 5: 108,802,236 (GRCm39) M443K probably damaging Het
Dhx32 A T 7: 133,339,057 (GRCm39) L326Q probably damaging Het
Dtwd1 A G 2: 126,000,342 (GRCm39) I93V probably benign Het
Ehmt2 C T 17: 35,118,357 (GRCm39) T44I probably benign Het
Enc1 T C 13: 97,381,765 (GRCm39) S92P probably benign Het
Epha5 T C 5: 84,479,051 (GRCm39) probably benign Het
Eya4 T A 10: 23,031,892 (GRCm39) S244C probably damaging Het
Fmnl3 G A 15: 99,223,791 (GRCm39) R302W probably damaging Het
Fscn3 A T 6: 28,436,173 (GRCm39) I490F possibly damaging Het
Galntl6 A G 8: 58,415,436 (GRCm39) V239A probably benign Het
Glg1 T C 8: 111,892,323 (GRCm39) I841V possibly damaging Het
Gm15455 T C 1: 33,876,893 (GRCm39) noncoding transcript Het
Gpd1l C T 9: 114,743,473 (GRCm39) M142I probably benign Het
Helb A G 10: 119,927,653 (GRCm39) V819A possibly damaging Het
Hnrnpul2 T G 19: 8,802,255 (GRCm39) F374C probably damaging Het
Hoxc10 G A 15: 102,875,753 (GRCm39) S154N possibly damaging Het
Ice2 A T 9: 69,319,651 (GRCm39) T367S possibly damaging Het
Iqca1 A T 1: 90,067,819 (GRCm39) probably null Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Klhl14 T A 18: 21,784,677 (GRCm39) H250L probably damaging Het
Kmt2c A T 5: 25,535,801 (GRCm39) D1447E probably benign Het
Larp1 G T 11: 57,940,765 (GRCm39) M630I probably benign Het
Lrp2 A G 2: 69,326,667 (GRCm39) probably null Het
Map4k3 G T 17: 80,911,427 (GRCm39) Q673K probably benign Het
Mettl16 A G 11: 74,686,823 (GRCm39) N201D possibly damaging Het
Mrpl15 C A 1: 4,855,956 (GRCm39) probably benign Het
Mthfd1l T A 10: 3,998,222 (GRCm39) V655D probably damaging Het
Odf1 T C 15: 38,226,531 (GRCm39) Y144H probably damaging Het
Or2f1b G T 6: 42,739,493 (GRCm39) C169F probably damaging Het
Or5t5 G T 2: 86,616,571 (GRCm39) V166L probably benign Het
Padi1 T C 4: 140,542,140 (GRCm39) Y594C probably damaging Het
Palm3 T A 8: 84,756,049 (GRCm39) D520E probably benign Het
Paox G A 7: 139,707,567 (GRCm39) C130Y probably damaging Het
Parpbp T A 10: 87,975,769 (GRCm39) S115C probably damaging Het
Pcnx3 A G 19: 5,721,708 (GRCm39) V1438A possibly damaging Het
Pdlim2 T A 14: 70,405,229 (GRCm39) D212V probably benign Het
Pi4ka A G 16: 17,121,006 (GRCm39) F53L probably damaging Het
Pik3c2a A T 7: 115,967,419 (GRCm39) D839E probably damaging Het
Pou2f1 T C 1: 165,710,625 (GRCm39) probably benign Het
Ppl A T 16: 4,906,492 (GRCm39) Y1268N probably benign Het
Prelid3a C T 18: 67,598,011 (GRCm39) S6L probably benign Het
Ptk2 T G 15: 73,175,682 (GRCm39) D285A possibly damaging Het
Rasd2 T G 8: 75,948,811 (GRCm39) Y246D probably damaging Het
Rhbdl2 A G 4: 123,708,120 (GRCm39) T110A probably benign Het
Rhobtb1 T A 10: 69,106,085 (GRCm39) F217I probably damaging Het
Serhl T C 15: 82,987,237 (GRCm39) probably benign Het
Sh3tc2 A G 18: 62,123,078 (GRCm39) E613G probably damaging Het
Slc26a3 A G 12: 31,502,714 (GRCm39) probably benign Het
Steap4 T C 5: 8,025,769 (GRCm39) I110T probably benign Het
Syde1 C A 10: 78,425,150 (GRCm39) R287L possibly damaging Het
Tmem184c C T 8: 78,325,291 (GRCm39) probably null Het
Ttbk2 G T 2: 120,603,764 (GRCm39) S256R probably benign Het
Ttll6 A T 11: 96,036,336 (GRCm39) I322F probably damaging Het
Ubap2 A T 4: 41,205,753 (GRCm39) probably null Het
Wsb2 A T 5: 117,515,600 (GRCm39) T402S probably damaging Het
Other mutations in Trmt44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01325:Trmt44 APN 5 35,726,147 (GRCm39) missense possibly damaging 0.61
IGL02139:Trmt44 APN 5 35,726,143 (GRCm39) nonsense probably null
IGL02223:Trmt44 APN 5 35,731,989 (GRCm39) missense probably benign 0.00
IGL02273:Trmt44 APN 5 35,731,457 (GRCm39) missense probably damaging 1.00
IGL02667:Trmt44 APN 5 35,728,396 (GRCm39) missense probably damaging 1.00
IGL03144:Trmt44 APN 5 35,721,766 (GRCm39) missense probably benign 0.27
R0207:Trmt44 UTSW 5 35,730,261 (GRCm39) missense possibly damaging 0.95
R0540:Trmt44 UTSW 5 35,726,103 (GRCm39) critical splice donor site probably null
R0607:Trmt44 UTSW 5 35,726,103 (GRCm39) critical splice donor site probably null
R1681:Trmt44 UTSW 5 35,727,321 (GRCm39) missense probably benign 0.13
R1746:Trmt44 UTSW 5 35,721,403 (GRCm39) missense probably benign 0.00
R2128:Trmt44 UTSW 5 35,732,176 (GRCm39) missense probably benign 0.05
R4190:Trmt44 UTSW 5 35,732,314 (GRCm39) missense possibly damaging 0.60
R4611:Trmt44 UTSW 5 35,732,351 (GRCm39) missense probably benign 0.13
R4684:Trmt44 UTSW 5 35,715,387 (GRCm39) missense probably benign 0.07
R5114:Trmt44 UTSW 5 35,722,812 (GRCm39) missense possibly damaging 0.67
R6125:Trmt44 UTSW 5 35,722,842 (GRCm39) missense probably damaging 1.00
R7131:Trmt44 UTSW 5 35,728,410 (GRCm39) missense probably damaging 1.00
R7239:Trmt44 UTSW 5 35,732,130 (GRCm39) missense probably benign 0.00
R7265:Trmt44 UTSW 5 35,721,647 (GRCm39) missense probably benign 0.13
R7561:Trmt44 UTSW 5 35,715,336 (GRCm39) missense possibly damaging 0.47
R8543:Trmt44 UTSW 5 35,732,374 (GRCm39) missense probably benign 0.01
R8552:Trmt44 UTSW 5 35,722,744 (GRCm39) missense probably benign 0.04
R8560:Trmt44 UTSW 5 35,715,295 (GRCm39) missense probably benign 0.00
R8850:Trmt44 UTSW 5 35,721,673 (GRCm39) missense probably benign 0.02
R9209:Trmt44 UTSW 5 35,731,422 (GRCm39) critical splice donor site probably null
R9330:Trmt44 UTSW 5 35,727,264 (GRCm39) missense probably damaging 1.00
R9588:Trmt44 UTSW 5 35,727,256 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTAAACTGGCCAGATCCACAG -3'
(R):5'- GTCTATCCTAAGCCTGCCTG -3'

Sequencing Primer
(F):5'- TTCAGGCTAACATGGGCTAC -3'
(R):5'- CCTGGCTCGGAGAAGAACTG -3'
Posted On 2017-03-31