Incidental Mutation 'R5951:Olfr38'
ID470884
Institutional Source Beutler Lab
Gene Symbol Olfr38
Ensembl Gene ENSMUSG00000095236
Gene Nameolfactory receptor 38
SynonymsMOR257-2, 18A, GA_x6K02T2P3E9-4797841-4796888
MMRRC Submission 044141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R5951 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42756404-42763231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 42762559 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 169 (C169F)
Ref Sequence ENSEMBL: ENSMUSP00000149726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074499] [ENSMUST00000215796]
Predicted Effect probably damaging
Transcript: ENSMUST00000074499
AA Change: C169F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093654
Gene: ENSMUSG00000095236
AA Change: C169F

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.8e-52 PFAM
Pfam:7tm_1 41 290 5.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215796
AA Change: C169F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3068 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,799 E180D probably damaging Het
Add3 A G 19: 53,244,289 probably null Het
Adgrv1 A T 13: 81,442,501 I4396N probably damaging Het
Apc C T 18: 34,317,146 S2331L possibly damaging Het
Apoh G T 11: 108,395,903 C51F probably damaging Het
Arid4b T C 13: 14,143,063 V177A possibly damaging Het
Atp13a1 T A 8: 69,797,285 I343N probably damaging Het
Bcar1 T C 8: 111,713,400 D654G probably benign Het
Brox T C 1: 183,282,508 K245R probably damaging Het
Ccdc146 A T 5: 21,319,579 S258R possibly damaging Het
Ccdc169 A C 3: 55,140,141 K18Q probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Crot C A 5: 8,969,120 E478* probably null Het
Dgkq A T 5: 108,654,370 M443K probably damaging Het
Dhx32 A T 7: 133,737,328 L326Q probably damaging Het
Dtwd1 A G 2: 126,158,422 I93V probably benign Het
Ehmt2 C T 17: 34,899,381 T44I probably benign Het
Enc1 T C 13: 97,245,257 S92P probably benign Het
Epha5 T C 5: 84,331,192 probably benign Het
Eya4 T A 10: 23,155,994 S244C probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Fscn3 A T 6: 28,436,174 I490F possibly damaging Het
Galntl6 A G 8: 57,962,402 V239A probably benign Het
Glg1 T C 8: 111,165,691 I841V possibly damaging Het
Gm15455 T C 1: 33,837,812 noncoding transcript Het
Gpd1l C T 9: 114,914,405 M142I probably benign Het
Helb A G 10: 120,091,748 V819A possibly damaging Het
Hnrnpul2 T G 19: 8,824,891 F374C probably damaging Het
Hoxc10 G A 15: 102,967,318 S154N possibly damaging Het
Ice2 A T 9: 69,412,369 T367S possibly damaging Het
Iqca A T 1: 90,140,097 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Kmt2c A T 5: 25,330,803 D1447E probably benign Het
Larp1 G T 11: 58,049,939 M630I probably benign Het
Lrp2 A G 2: 69,496,323 probably null Het
Map4k3 G T 17: 80,603,998 Q673K probably benign Het
Mettl16 A G 11: 74,795,997 N201D possibly damaging Het
Mrpl15 C A 1: 4,785,733 probably benign Het
Mthfd1l T A 10: 4,048,222 V655D probably damaging Het
Odf1 T C 15: 38,226,287 Y144H probably damaging Het
Olfr1093 G T 2: 86,786,227 V166L probably benign Het
Padi1 T C 4: 140,814,829 Y594C probably damaging Het
Palm3 T A 8: 84,029,420 D520E probably benign Het
Paox G A 7: 140,127,654 C130Y probably damaging Het
Parpbp T A 10: 88,139,907 S115C probably damaging Het
Pcnx3 A G 19: 5,671,680 V1438A possibly damaging Het
Pdlim2 T A 14: 70,167,780 D212V probably benign Het
Pi4ka A G 16: 17,303,142 F53L probably damaging Het
Pik3c2a A T 7: 116,368,184 D839E probably damaging Het
Pou2f1 T C 1: 165,883,056 probably benign Het
Ppl A T 16: 5,088,628 Y1268N probably benign Het
Prelid3a C T 18: 67,464,941 S6L probably benign Het
Ptk2 T G 15: 73,303,833 D285A possibly damaging Het
Rasd2 T G 8: 75,222,183 Y246D probably damaging Het
Rhbdl2 A G 4: 123,814,327 T110A probably benign Het
Rhobtb1 T A 10: 69,270,255 F217I probably damaging Het
Serhl T C 15: 83,103,036 probably benign Het
Sh3tc2 A G 18: 61,990,007 E613G probably damaging Het
Slc26a3 A G 12: 31,452,715 probably benign Het
Steap4 T C 5: 7,975,769 I110T probably benign Het
Syde1 C A 10: 78,589,316 R287L possibly damaging Het
Tmem184c C T 8: 77,598,662 probably null Het
Trmt44 C A 5: 35,572,688 probably benign Het
Ttbk2 G T 2: 120,773,283 S256R probably benign Het
Ttll6 A T 11: 96,145,510 I322F probably damaging Het
Ubap2 A T 4: 41,205,753 probably null Het
Wsb2 A T 5: 117,377,535 T402S probably damaging Het
Other mutations in Olfr38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Olfr38 APN 6 42762112 missense probably damaging 0.99
IGL01567:Olfr38 APN 6 42762727 missense probably benign 0.07
IGL02097:Olfr38 APN 6 42762460 missense probably damaging 0.98
IGL02186:Olfr38 APN 6 42762946 missense probably null 0.96
IGL02473:Olfr38 APN 6 42762706 missense probably damaging 1.00
R0541:Olfr38 UTSW 6 42762220 missense probably damaging 1.00
R1210:Olfr38 UTSW 6 42762667 missense possibly damaging 0.79
R1368:Olfr38 UTSW 6 42762679 missense possibly damaging 0.91
R2383:Olfr38 UTSW 6 42762459 missense probably benign 0.44
R4614:Olfr38 UTSW 6 42762418 missense probably benign 0.07
R4616:Olfr38 UTSW 6 42762418 missense probably benign 0.07
R4844:Olfr38 UTSW 6 42762460 missense probably damaging 0.98
R5121:Olfr38 UTSW 6 42762997 nonsense probably null
R6061:Olfr38 UTSW 6 42762965 missense probably damaging 0.99
R6336:Olfr38 UTSW 6 42762657 missense probably damaging 1.00
R7414:Olfr38 UTSW 6 42762828 missense probably damaging 1.00
X0018:Olfr38 UTSW 6 42762935 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCATTTCTGAGCTGTGCAG -3'
(R):5'- TGAAAGGCTTTCCACCTTCC -3'

Sequencing Primer
(F):5'- TGGGATTGAGTTCCTTCTGC -3'
(R):5'- CCTCTGTGGACTGTATCTTTAAGATG -3'
Posted On2017-03-31