Incidental Mutation 'R5951:Galntl6'
ID470888
Institutional Source Beutler Lab
Gene Symbol Galntl6
Ensembl Gene ENSMUSG00000096914
Gene NameUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Synonyms
MMRRC Submission 044141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5951 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location57774052-58912640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57962402 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 239 (V239A)
Ref Sequence ENSEMBL: ENSMUSP00000145321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000204128]
Predicted Effect unknown
Transcript: ENSMUST00000098757
AA Change: V54A
SMART Domains Protein: ENSMUSP00000096353
Gene: ENSMUSG00000096914
AA Change: V54A

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 1 144 1.6e-18 PFAM
Pfam:Glyco_transf_7C 113 187 3.6e-12 PFAM
RICIN 268 401 7.9e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000204128
AA Change: V239A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000145321
Gene: ENSMUSG00000096914
AA Change: V239A

DomainStartEndE-ValueType
transmembrane domain 13 31 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 140 404 2.1e-9 PFAM
Pfam:Glycos_transf_2 143 328 7.3e-33 PFAM
Pfam:Glyco_tranf_2_2 143 356 1.2e-8 PFAM
Pfam:Glyco_transf_7C 297 371 6.2e-12 PFAM
RICIN 452 585 7.9e-21 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,799 E180D probably damaging Het
Add3 A G 19: 53,244,289 probably null Het
Adgrv1 A T 13: 81,442,501 I4396N probably damaging Het
Apc C T 18: 34,317,146 S2331L possibly damaging Het
Apoh G T 11: 108,395,903 C51F probably damaging Het
Arid4b T C 13: 14,143,063 V177A possibly damaging Het
Atp13a1 T A 8: 69,797,285 I343N probably damaging Het
Bcar1 T C 8: 111,713,400 D654G probably benign Het
Brox T C 1: 183,282,508 K245R probably damaging Het
Ccdc146 A T 5: 21,319,579 S258R possibly damaging Het
Ccdc169 A C 3: 55,140,141 K18Q probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Crot C A 5: 8,969,120 E478* probably null Het
Dgkq A T 5: 108,654,370 M443K probably damaging Het
Dhx32 A T 7: 133,737,328 L326Q probably damaging Het
Dtwd1 A G 2: 126,158,422 I93V probably benign Het
Ehmt2 C T 17: 34,899,381 T44I probably benign Het
Enc1 T C 13: 97,245,257 S92P probably benign Het
Epha5 T C 5: 84,331,192 probably benign Het
Eya4 T A 10: 23,155,994 S244C probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Fscn3 A T 6: 28,436,174 I490F possibly damaging Het
Glg1 T C 8: 111,165,691 I841V possibly damaging Het
Gm15455 T C 1: 33,837,812 noncoding transcript Het
Gpd1l C T 9: 114,914,405 M142I probably benign Het
Helb A G 10: 120,091,748 V819A possibly damaging Het
Hnrnpul2 T G 19: 8,824,891 F374C probably damaging Het
Hoxc10 G A 15: 102,967,318 S154N possibly damaging Het
Ice2 A T 9: 69,412,369 T367S possibly damaging Het
Iqca A T 1: 90,140,097 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Kmt2c A T 5: 25,330,803 D1447E probably benign Het
Larp1 G T 11: 58,049,939 M630I probably benign Het
Lrp2 A G 2: 69,496,323 probably null Het
Map4k3 G T 17: 80,603,998 Q673K probably benign Het
Mettl16 A G 11: 74,795,997 N201D possibly damaging Het
Mrpl15 C A 1: 4,785,733 probably benign Het
Mthfd1l T A 10: 4,048,222 V655D probably damaging Het
Odf1 T C 15: 38,226,287 Y144H probably damaging Het
Olfr1093 G T 2: 86,786,227 V166L probably benign Het
Olfr38 G T 6: 42,762,559 C169F probably damaging Het
Padi1 T C 4: 140,814,829 Y594C probably damaging Het
Palm3 T A 8: 84,029,420 D520E probably benign Het
Paox G A 7: 140,127,654 C130Y probably damaging Het
Parpbp T A 10: 88,139,907 S115C probably damaging Het
Pcnx3 A G 19: 5,671,680 V1438A possibly damaging Het
Pdlim2 T A 14: 70,167,780 D212V probably benign Het
Pi4ka A G 16: 17,303,142 F53L probably damaging Het
Pik3c2a A T 7: 116,368,184 D839E probably damaging Het
Pou2f1 T C 1: 165,883,056 probably benign Het
Ppl A T 16: 5,088,628 Y1268N probably benign Het
Prelid3a C T 18: 67,464,941 S6L probably benign Het
Ptk2 T G 15: 73,303,833 D285A possibly damaging Het
Rasd2 T G 8: 75,222,183 Y246D probably damaging Het
Rhbdl2 A G 4: 123,814,327 T110A probably benign Het
Rhobtb1 T A 10: 69,270,255 F217I probably damaging Het
Serhl T C 15: 83,103,036 probably benign Het
Sh3tc2 A G 18: 61,990,007 E613G probably damaging Het
Slc26a3 A G 12: 31,452,715 probably benign Het
Steap4 T C 5: 7,975,769 I110T probably benign Het
Syde1 C A 10: 78,589,316 R287L possibly damaging Het
Tmem184c C T 8: 77,598,662 probably null Het
Trmt44 C A 5: 35,572,688 probably benign Het
Ttbk2 G T 2: 120,773,283 S256R probably benign Het
Ttll6 A T 11: 96,145,510 I322F probably damaging Het
Ubap2 A T 4: 41,205,753 probably null Het
Wsb2 A T 5: 117,377,535 T402S probably damaging Het
Other mutations in Galntl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Galntl6 APN 8 57857540 missense probably damaging 1.00
IGL00557:Galntl6 APN 8 58911417 missense possibly damaging 0.71
IGL01140:Galntl6 APN 8 57958322 missense probably damaging 1.00
IGL01412:Galntl6 APN 8 57777294 missense probably damaging 0.99
IGL01458:Galntl6 APN 8 58427709 missense probably damaging 1.00
IGL01575:Galntl6 APN 8 58427676 intron probably benign
IGL01700:Galntl6 APN 8 57958460 splice site probably benign
IGL01710:Galntl6 APN 8 58535968 missense probably damaging 0.97
IGL02611:Galntl6 APN 8 57958416 missense probably damaging 1.00
IGL02880:Galntl6 APN 8 57804272 missense probably benign 0.44
IGL03129:Galntl6 APN 8 58427716 missense probably damaging 1.00
IGL03215:Galntl6 APN 8 58911402 missense probably benign 0.00
IGL03249:Galntl6 APN 8 57777176 utr 3 prime probably benign
Indubitably UTSW 8 58427770 missense probably damaging 1.00
PIT4677001:Galntl6 UTSW 8 57857587 missense probably damaging 1.00
R0600:Galntl6 UTSW 8 57837183 splice site probably null
R0731:Galntl6 UTSW 8 58535984 missense probably benign
R0961:Galntl6 UTSW 8 58911340 missense probably benign
R1381:Galntl6 UTSW 8 58472955 missense probably damaging 0.99
R2137:Galntl6 UTSW 8 58535905 critical splice donor site probably null
R4632:Galntl6 UTSW 8 58427823 missense probably damaging 1.00
R4731:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4732:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4733:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4920:Galntl6 UTSW 8 58427773 missense probably damaging 0.97
R4964:Galntl6 UTSW 8 58699911 intron probably benign
R5357:Galntl6 UTSW 8 57884463 missense probably damaging 0.99
R5526:Galntl6 UTSW 8 58472970 missense probably benign
R5965:Galntl6 UTSW 8 57857531 missense probably benign 0.03
R6260:Galntl6 UTSW 8 57884481 missense probably damaging 1.00
R6368:Galntl6 UTSW 8 58911441 missense probably damaging 1.00
R6695:Galntl6 UTSW 8 58427770 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGCCGGTACTATCTGAAG -3'
(R):5'- TTCCTTCCTAGAACACTTGAAGG -3'

Sequencing Primer
(F):5'- CCCATTATACTTGTGATCAGCAGTG -3'
(R):5'- CATGGCTCGGTTTTCCAA -3'
Posted On2017-03-31