Incidental Mutation 'R5951:Helb'
ID470902
Institutional Source Beutler Lab
Gene Symbol Helb
Ensembl Gene ENSMUSG00000020228
Gene Namehelicase (DNA) B
SynonymsD10Ertd664e
MMRRC Submission 044141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R5951 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location120083608-120112987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120091748 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 819 (V819A)
Ref Sequence ENSEMBL: ENSMUSP00000020449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020449] [ENSMUST00000081260] [ENSMUST00000130387] [ENSMUST00000144959] [ENSMUST00000147356] [ENSMUST00000154501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020449
AA Change: V819A

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020449
Gene: ENSMUSG00000020228
AA Change: V819A

DomainStartEndE-ValueType
low complexity region 20 43 N/A INTRINSIC
Pfam:AAA_30 434 661 4.8e-24 PFAM
Pfam:UvrD_C_2 855 901 2.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081260
SMART Domains Protein: ENSMUSP00000080016
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 3e-19 SMART
PDZ 166 242 5.2e-19 SMART
PDZ 265 339 8.4e-21 SMART
PDZ 518 590 1.4e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130387
SMART Domains Protein: ENSMUSP00000123288
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
PDZ 65 145 6.36e-17 SMART
PDZ 166 242 1.11e-16 SMART
PDZ 265 339 1.73e-18 SMART
PDZ 583 655 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144959
SMART Domains Protein: ENSMUSP00000122323
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
PDZ 62 136 4.86e-13 SMART
PDZ 160 238 6.4e-22 SMART
PDZ 261 336 1.97e-13 SMART
low complexity region 393 421 N/A INTRINSIC
low complexity region 439 456 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
PDZ 480 560 6.36e-17 SMART
PDZ 581 657 1.11e-16 SMART
PDZ 680 754 1.73e-18 SMART
PDZ 998 1070 2.79e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147356
SMART Domains Protein: ENSMUSP00000115478
Gene: ENSMUSG00000034813

DomainStartEndE-ValueType
PDZ 63 137 4.86e-13 SMART
PDZ 161 239 6.4e-22 SMART
PDZ 262 337 1.97e-13 SMART
low complexity region 394 422 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
low complexity region 465 476 N/A INTRINSIC
PDZ 481 561 6.36e-17 SMART
PDZ 582 658 1.11e-16 SMART
PDZ 681 755 1.73e-18 SMART
PDZ 999 1071 2.79e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148241
Predicted Effect probably benign
Transcript: ENSMUST00000154501
SMART Domains Protein: ENSMUSP00000116954
Gene: ENSMUSG00000020228

DomainStartEndE-ValueType
low complexity region 20 43 N/A INTRINSIC
Pfam:AAA_30 434 546 1.2e-8 PFAM
Meta Mutation Damage Score 0.1781 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-dependent ATPase which catalyzes the unwinding of DNA necessary for DNA replication, repair, recombination, and transcription. This gene is thought to function specifically during the S phase entry of the cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous knockout MEFs display increased DNA end resection, resulting in increased level of single-strand DNA formation at double-strand DNA breaks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,799 E180D probably damaging Het
Add3 A G 19: 53,244,289 probably null Het
Adgrv1 A T 13: 81,442,501 I4396N probably damaging Het
Apc C T 18: 34,317,146 S2331L possibly damaging Het
Apoh G T 11: 108,395,903 C51F probably damaging Het
Arid4b T C 13: 14,143,063 V177A possibly damaging Het
Atp13a1 T A 8: 69,797,285 I343N probably damaging Het
Bcar1 T C 8: 111,713,400 D654G probably benign Het
Brox T C 1: 183,282,508 K245R probably damaging Het
Ccdc146 A T 5: 21,319,579 S258R possibly damaging Het
Ccdc169 A C 3: 55,140,141 K18Q probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Crot C A 5: 8,969,120 E478* probably null Het
Dgkq A T 5: 108,654,370 M443K probably damaging Het
Dhx32 A T 7: 133,737,328 L326Q probably damaging Het
Dtwd1 A G 2: 126,158,422 I93V probably benign Het
Ehmt2 C T 17: 34,899,381 T44I probably benign Het
Enc1 T C 13: 97,245,257 S92P probably benign Het
Epha5 T C 5: 84,331,192 probably benign Het
Eya4 T A 10: 23,155,994 S244C probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Fscn3 A T 6: 28,436,174 I490F possibly damaging Het
Galntl6 A G 8: 57,962,402 V239A probably benign Het
Glg1 T C 8: 111,165,691 I841V possibly damaging Het
Gm15455 T C 1: 33,837,812 noncoding transcript Het
Gpd1l C T 9: 114,914,405 M142I probably benign Het
Hnrnpul2 T G 19: 8,824,891 F374C probably damaging Het
Hoxc10 G A 15: 102,967,318 S154N possibly damaging Het
Ice2 A T 9: 69,412,369 T367S possibly damaging Het
Iqca A T 1: 90,140,097 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Kmt2c A T 5: 25,330,803 D1447E probably benign Het
Larp1 G T 11: 58,049,939 M630I probably benign Het
Lrp2 A G 2: 69,496,323 probably null Het
Map4k3 G T 17: 80,603,998 Q673K probably benign Het
Mettl16 A G 11: 74,795,997 N201D possibly damaging Het
Mrpl15 C A 1: 4,785,733 probably benign Het
Mthfd1l T A 10: 4,048,222 V655D probably damaging Het
Odf1 T C 15: 38,226,287 Y144H probably damaging Het
Olfr1093 G T 2: 86,786,227 V166L probably benign Het
Olfr38 G T 6: 42,762,559 C169F probably damaging Het
Padi1 T C 4: 140,814,829 Y594C probably damaging Het
Palm3 T A 8: 84,029,420 D520E probably benign Het
Paox G A 7: 140,127,654 C130Y probably damaging Het
Parpbp T A 10: 88,139,907 S115C probably damaging Het
Pcnx3 A G 19: 5,671,680 V1438A possibly damaging Het
Pdlim2 T A 14: 70,167,780 D212V probably benign Het
Pi4ka A G 16: 17,303,142 F53L probably damaging Het
Pik3c2a A T 7: 116,368,184 D839E probably damaging Het
Pou2f1 T C 1: 165,883,056 probably benign Het
Ppl A T 16: 5,088,628 Y1268N probably benign Het
Prelid3a C T 18: 67,464,941 S6L probably benign Het
Ptk2 T G 15: 73,303,833 D285A possibly damaging Het
Rasd2 T G 8: 75,222,183 Y246D probably damaging Het
Rhbdl2 A G 4: 123,814,327 T110A probably benign Het
Rhobtb1 T A 10: 69,270,255 F217I probably damaging Het
Serhl T C 15: 83,103,036 probably benign Het
Sh3tc2 A G 18: 61,990,007 E613G probably damaging Het
Slc26a3 A G 12: 31,452,715 probably benign Het
Steap4 T C 5: 7,975,769 I110T probably benign Het
Syde1 C A 10: 78,589,316 R287L possibly damaging Het
Tmem184c C T 8: 77,598,662 probably null Het
Trmt44 C A 5: 35,572,688 probably benign Het
Ttbk2 G T 2: 120,773,283 S256R probably benign Het
Ttll6 A T 11: 96,145,510 I322F probably damaging Het
Ubap2 A T 4: 41,205,753 probably null Het
Wsb2 A T 5: 117,377,535 T402S probably damaging Het
Other mutations in Helb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Helb APN 10 120098245 missense possibly damaging 0.88
IGL00516:Helb APN 10 120105424 missense probably damaging 1.00
IGL00924:Helb APN 10 120110984 missense probably benign 0.01
IGL00971:Helb APN 10 120094263 missense possibly damaging 0.50
IGL01142:Helb APN 10 120111144 missense probably damaging 1.00
IGL01483:Helb APN 10 120111138 missense probably damaging 1.00
IGL01688:Helb APN 10 120108980 missense probably damaging 0.99
IGL01860:Helb APN 10 120102833 missense probably damaging 0.97
IGL02298:Helb APN 10 120101526 missense probably damaging 1.00
IGL02501:Helb APN 10 120102788 missense possibly damaging 0.96
IGL02554:Helb APN 10 120089712 missense probably damaging 1.00
IGL02810:Helb APN 10 120091703 missense possibly damaging 0.48
IGL02902:Helb APN 10 120089485 missense probably benign 0.00
IGL03405:Helb APN 10 120089796 missense probably damaging 1.00
R0004:Helb UTSW 10 120108981 missense probably damaging 1.00
R0092:Helb UTSW 10 120089808 missense probably damaging 1.00
R0436:Helb UTSW 10 120094212 splice site probably benign
R0850:Helb UTSW 10 120105367 missense probably damaging 1.00
R1423:Helb UTSW 10 120108966 missense probably damaging 0.99
R1663:Helb UTSW 10 120105433 missense probably damaging 1.00
R1756:Helb UTSW 10 120094242 missense probably damaging 0.96
R1812:Helb UTSW 10 120089566 nonsense probably null
R1976:Helb UTSW 10 120094263 missense possibly damaging 0.50
R2049:Helb UTSW 10 120106021 missense possibly damaging 0.74
R2063:Helb UTSW 10 120105766 missense probably benign
R2141:Helb UTSW 10 120106021 missense possibly damaging 0.74
R2180:Helb UTSW 10 120105448 missense probably benign 0.02
R2432:Helb UTSW 10 120105537 missense probably benign 0.01
R3030:Helb UTSW 10 120089582 nonsense probably null
R3874:Helb UTSW 10 120106037 missense probably benign 0.31
R3978:Helb UTSW 10 120089625 missense probably benign
R4731:Helb UTSW 10 120094288 critical splice acceptor site probably null
R4734:Helb UTSW 10 120084849 missense probably benign
R4748:Helb UTSW 10 120084849 missense probably benign
R4749:Helb UTSW 10 120084849 missense probably benign
R4840:Helb UTSW 10 120084858 missense probably benign 0.33
R4977:Helb UTSW 10 120110881 missense probably benign 0.01
R5149:Helb UTSW 10 120105743 missense probably benign 0.39
R5220:Helb UTSW 10 120101486 missense probably damaging 1.00
R5447:Helb UTSW 10 120102901 missense possibly damaging 0.88
R5637:Helb UTSW 10 120105448 missense probably benign 0.02
R5660:Helb UTSW 10 120111079 nonsense probably null
R5663:Helb UTSW 10 120105793 missense possibly damaging 0.61
R5806:Helb UTSW 10 120092519 missense probably damaging 1.00
R6010:Helb UTSW 10 120105883 missense probably damaging 1.00
R6183:Helb UTSW 10 120112998 unclassified probably null
R6578:Helb UTSW 10 120111181 missense probably damaging 1.00
R6642:Helb UTSW 10 120084930 missense probably benign 0.17
R6666:Helb UTSW 10 120084951 missense probably damaging 0.99
R6705:Helb UTSW 10 120089811 unclassified probably null
R6746:Helb UTSW 10 120105468 missense probably damaging 1.00
R7114:Helb UTSW 10 120105256 missense probably benign 0.09
R7396:Helb UTSW 10 120089571 missense probably benign
R7422:Helb UTSW 10 120108894 missense probably damaging 1.00
R7508:Helb UTSW 10 120105283 missense probably benign 0.04
R7509:Helb UTSW 10 120089814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCATGTACTTCCTGTTGTGG -3'
(R):5'- GAGCCTCACAAGTACCGTTC -3'

Sequencing Primer
(F):5'- CCCACTGTAAATATGGGGGCATTC -3'
(R):5'- GTTCACATGCTCTGCAACTACAG -3'
Posted On2017-03-31