Incidental Mutation 'R5951:Slc26a3'
ID 470908
Institutional Source Beutler Lab
Gene Symbol Slc26a3
Ensembl Gene ENSMUSG00000001225
Gene Name solute carrier family 26, member 3
Synonyms 9130013M11Rik, 9030623B18Rik, Dra
MMRRC Submission 044141-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.759) question?
Stock # R5951 (G1)
Quality Score 206
Status Validated
Chromosome 12
Chromosomal Location 31483141-31523921 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 31502714 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001254] [ENSMUST00000110854] [ENSMUST00000167432] [ENSMUST00000171616]
AlphaFold Q9WVC8
Predicted Effect probably benign
Transcript: ENSMUST00000001254
SMART Domains Protein: ENSMUSP00000001254
Gene: ENSMUSG00000001225

DomainStartEndE-ValueType
Pfam:Sulfate_transp 73 468 3.1e-115 PFAM
low complexity region 475 481 N/A INTRINSIC
Pfam:STAS 519 709 2e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165816
Predicted Effect probably benign
Transcript: ENSMUST00000167432
SMART Domains Protein: ENSMUSP00000130676
Gene: ENSMUSG00000001225

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 58 141 5.3e-31 PFAM
Pfam:Sulfate_transp 186 235 8.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168209
Predicted Effect probably benign
Transcript: ENSMUST00000171616
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: This gene encodes a member of the solute carrier/sulfate transporter family. The encoded protein is predominantly expressed in the intestine where it is essential for chloride absorption. Disruption of this gene results in chloride-rich diarrhea and compensatory up-regulation of ion-absorbing transporters. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a null allele display partial postnatal lethality; survivors are small and show lower luminal Cl-/HCO3- exchange activity, acidic chloridorrhea, volume depletion, upregulation of ion transporters, dilated colons, higher crypt proliferation and plasma aldosterone, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,244,811 (GRCm39) E180D probably damaging Het
Add3 A G 19: 53,232,720 (GRCm39) probably null Het
Adgrv1 A T 13: 81,590,620 (GRCm39) I4396N probably damaging Het
Apc C T 18: 34,450,199 (GRCm39) S2331L possibly damaging Het
Apoh G T 11: 108,286,729 (GRCm39) C51F probably damaging Het
Arid4b T C 13: 14,317,648 (GRCm39) V177A possibly damaging Het
Atp13a1 T A 8: 70,249,935 (GRCm39) I343N probably damaging Het
Bcar1 T C 8: 112,440,032 (GRCm39) D654G probably benign Het
Brox T C 1: 183,064,072 (GRCm39) K245R probably damaging Het
Ccdc146 A T 5: 21,524,577 (GRCm39) S258R possibly damaging Het
Ccdc169 A C 3: 55,047,562 (GRCm39) K18Q probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Crot C A 5: 9,019,120 (GRCm39) E478* probably null Het
Dgkq A T 5: 108,802,236 (GRCm39) M443K probably damaging Het
Dhx32 A T 7: 133,339,057 (GRCm39) L326Q probably damaging Het
Dtwd1 A G 2: 126,000,342 (GRCm39) I93V probably benign Het
Ehmt2 C T 17: 35,118,357 (GRCm39) T44I probably benign Het
Enc1 T C 13: 97,381,765 (GRCm39) S92P probably benign Het
Epha5 T C 5: 84,479,051 (GRCm39) probably benign Het
Eya4 T A 10: 23,031,892 (GRCm39) S244C probably damaging Het
Fmnl3 G A 15: 99,223,791 (GRCm39) R302W probably damaging Het
Fscn3 A T 6: 28,436,173 (GRCm39) I490F possibly damaging Het
Galntl6 A G 8: 58,415,436 (GRCm39) V239A probably benign Het
Glg1 T C 8: 111,892,323 (GRCm39) I841V possibly damaging Het
Gm15455 T C 1: 33,876,893 (GRCm39) noncoding transcript Het
Gpd1l C T 9: 114,743,473 (GRCm39) M142I probably benign Het
Helb A G 10: 119,927,653 (GRCm39) V819A possibly damaging Het
Hnrnpul2 T G 19: 8,802,255 (GRCm39) F374C probably damaging Het
Hoxc10 G A 15: 102,875,753 (GRCm39) S154N possibly damaging Het
Ice2 A T 9: 69,319,651 (GRCm39) T367S possibly damaging Het
Iqca1 A T 1: 90,067,819 (GRCm39) probably null Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Klhl14 T A 18: 21,784,677 (GRCm39) H250L probably damaging Het
Kmt2c A T 5: 25,535,801 (GRCm39) D1447E probably benign Het
Larp1 G T 11: 57,940,765 (GRCm39) M630I probably benign Het
Lrp2 A G 2: 69,326,667 (GRCm39) probably null Het
Map4k3 G T 17: 80,911,427 (GRCm39) Q673K probably benign Het
Mettl16 A G 11: 74,686,823 (GRCm39) N201D possibly damaging Het
Mrpl15 C A 1: 4,855,956 (GRCm39) probably benign Het
Mthfd1l T A 10: 3,998,222 (GRCm39) V655D probably damaging Het
Odf1 T C 15: 38,226,531 (GRCm39) Y144H probably damaging Het
Or2f1b G T 6: 42,739,493 (GRCm39) C169F probably damaging Het
Or5t5 G T 2: 86,616,571 (GRCm39) V166L probably benign Het
Padi1 T C 4: 140,542,140 (GRCm39) Y594C probably damaging Het
Palm3 T A 8: 84,756,049 (GRCm39) D520E probably benign Het
Paox G A 7: 139,707,567 (GRCm39) C130Y probably damaging Het
Parpbp T A 10: 87,975,769 (GRCm39) S115C probably damaging Het
Pcnx3 A G 19: 5,721,708 (GRCm39) V1438A possibly damaging Het
Pdlim2 T A 14: 70,405,229 (GRCm39) D212V probably benign Het
Pi4ka A G 16: 17,121,006 (GRCm39) F53L probably damaging Het
Pik3c2a A T 7: 115,967,419 (GRCm39) D839E probably damaging Het
Pou2f1 T C 1: 165,710,625 (GRCm39) probably benign Het
Ppl A T 16: 4,906,492 (GRCm39) Y1268N probably benign Het
Prelid3a C T 18: 67,598,011 (GRCm39) S6L probably benign Het
Ptk2 T G 15: 73,175,682 (GRCm39) D285A possibly damaging Het
Rasd2 T G 8: 75,948,811 (GRCm39) Y246D probably damaging Het
Rhbdl2 A G 4: 123,708,120 (GRCm39) T110A probably benign Het
Rhobtb1 T A 10: 69,106,085 (GRCm39) F217I probably damaging Het
Serhl T C 15: 82,987,237 (GRCm39) probably benign Het
Sh3tc2 A G 18: 62,123,078 (GRCm39) E613G probably damaging Het
Steap4 T C 5: 8,025,769 (GRCm39) I110T probably benign Het
Syde1 C A 10: 78,425,150 (GRCm39) R287L possibly damaging Het
Tmem184c C T 8: 78,325,291 (GRCm39) probably null Het
Trmt44 C A 5: 35,730,032 (GRCm39) probably benign Het
Ttbk2 G T 2: 120,603,764 (GRCm39) S256R probably benign Het
Ttll6 A T 11: 96,036,336 (GRCm39) I322F probably damaging Het
Ubap2 A T 4: 41,205,753 (GRCm39) probably null Het
Wsb2 A T 5: 117,515,600 (GRCm39) T402S probably damaging Het
Other mutations in Slc26a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Slc26a3 APN 12 31,502,490 (GRCm39) splice site probably benign
IGL01717:Slc26a3 APN 12 31,513,476 (GRCm39) missense probably benign 0.11
IGL02151:Slc26a3 APN 12 31,497,830 (GRCm39) missense probably damaging 0.99
IGL02374:Slc26a3 APN 12 31,520,832 (GRCm39) splice site probably benign
IGL02445:Slc26a3 APN 12 31,507,051 (GRCm39) missense possibly damaging 0.65
IGL02526:Slc26a3 APN 12 31,507,095 (GRCm39) missense probably damaging 1.00
IGL02831:Slc26a3 APN 12 31,502,628 (GRCm39) missense probably damaging 1.00
PIT4486001:Slc26a3 UTSW 12 31,520,949 (GRCm39) missense probably benign 0.01
R0422:Slc26a3 UTSW 12 31,515,848 (GRCm39) missense possibly damaging 0.90
R0544:Slc26a3 UTSW 12 31,497,739 (GRCm39) missense probably benign
R0781:Slc26a3 UTSW 12 31,515,812 (GRCm39) missense possibly damaging 0.90
R1561:Slc26a3 UTSW 12 31,516,451 (GRCm39) missense probably benign 0.18
R1860:Slc26a3 UTSW 12 31,515,845 (GRCm39) missense probably benign
R1954:Slc26a3 UTSW 12 31,500,815 (GRCm39) missense probably damaging 0.98
R1967:Slc26a3 UTSW 12 31,515,777 (GRCm39) missense probably damaging 0.99
R2240:Slc26a3 UTSW 12 31,507,071 (GRCm39) missense probably damaging 1.00
R2508:Slc26a3 UTSW 12 31,520,902 (GRCm39) missense probably damaging 0.99
R3894:Slc26a3 UTSW 12 31,514,719 (GRCm39) missense probably damaging 1.00
R3914:Slc26a3 UTSW 12 31,503,905 (GRCm39) missense probably benign 0.00
R3978:Slc26a3 UTSW 12 31,515,859 (GRCm39) splice site probably null
R4701:Slc26a3 UTSW 12 31,497,773 (GRCm39) missense probably damaging 1.00
R4713:Slc26a3 UTSW 12 31,507,079 (GRCm39) missense possibly damaging 0.75
R5024:Slc26a3 UTSW 12 31,503,907 (GRCm39) missense probably benign
R5058:Slc26a3 UTSW 12 31,520,964 (GRCm39) missense possibly damaging 0.66
R5168:Slc26a3 UTSW 12 31,518,553 (GRCm39) missense possibly damaging 0.81
R5361:Slc26a3 UTSW 12 31,500,980 (GRCm39) critical splice donor site probably null
R5715:Slc26a3 UTSW 12 31,498,842 (GRCm39) critical splice donor site probably null
R6662:Slc26a3 UTSW 12 31,507,345 (GRCm39) nonsense probably null
R6895:Slc26a3 UTSW 12 31,513,523 (GRCm39) missense probably damaging 0.96
R7069:Slc26a3 UTSW 12 31,500,934 (GRCm39) missense probably damaging 0.96
R7484:Slc26a3 UTSW 12 31,497,787 (GRCm39) missense probably benign 0.22
R7744:Slc26a3 UTSW 12 31,513,464 (GRCm39) critical splice acceptor site probably null
R8192:Slc26a3 UTSW 12 31,518,541 (GRCm39) missense probably benign 0.05
R8327:Slc26a3 UTSW 12 31,516,430 (GRCm39) missense possibly damaging 0.81
R8356:Slc26a3 UTSW 12 31,516,505 (GRCm39) missense probably benign 0.06
R8371:Slc26a3 UTSW 12 31,502,541 (GRCm39) missense probably damaging 1.00
R8550:Slc26a3 UTSW 12 31,511,739 (GRCm39) missense probably damaging 1.00
R9057:Slc26a3 UTSW 12 31,520,958 (GRCm39) missense probably benign 0.00
R9221:Slc26a3 UTSW 12 31,513,470 (GRCm39) missense possibly damaging 0.95
R9484:Slc26a3 UTSW 12 31,511,785 (GRCm39) missense probably damaging 0.98
R9746:Slc26a3 UTSW 12 31,499,145 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGAACATCGCAGACCTTGTG -3'
(R):5'- ATTCTGATTTGTACAGGCATCACAG -3'

Sequencing Primer
(F):5'- CGCAGACCTTGTGACATCTGTG -3'
(R):5'- GATTTGTACAGGCATCACAGCTCAAG -3'
Posted On 2017-03-31