Incidental Mutation 'R5951:Pdlim2'
ID 470912
Institutional Source Beutler Lab
Gene Symbol Pdlim2
Ensembl Gene ENSMUSG00000022090
Gene Name PDZ and LIM domain 2
Synonyms SLIM, 4732462F18Rik, mystique
MMRRC Submission 044141-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R5951 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 70401667-70415130 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 70405229 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 212 (D212V)
Ref Sequence ENSEMBL: ENSMUSP00000119222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000143393] [ENSMUST00000153735]
AlphaFold Q8R1G6
Predicted Effect probably benign
Transcript: ENSMUST00000022681
AA Change: D212V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: D212V

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123125
Predicted Effect unknown
Transcript: ENSMUST00000125300
AA Change: D13V
SMART Domains Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090
AA Change: D13V

DomainStartEndE-ValueType
Pfam:DUF4749 7 58 6.4e-13 PFAM
low complexity region 61 73 N/A INTRINSIC
LIM 84 136 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127836
SMART Domains Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129174
SMART Domains Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135944
Predicted Effect probably benign
Transcript: ENSMUST00000143393
AA Change: D212V

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090
AA Change: D212V

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153735
AA Change: D212V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: D212V

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,244,811 (GRCm39) E180D probably damaging Het
Add3 A G 19: 53,232,720 (GRCm39) probably null Het
Adgrv1 A T 13: 81,590,620 (GRCm39) I4396N probably damaging Het
Apc C T 18: 34,450,199 (GRCm39) S2331L possibly damaging Het
Apoh G T 11: 108,286,729 (GRCm39) C51F probably damaging Het
Arid4b T C 13: 14,317,648 (GRCm39) V177A possibly damaging Het
Atp13a1 T A 8: 70,249,935 (GRCm39) I343N probably damaging Het
Bcar1 T C 8: 112,440,032 (GRCm39) D654G probably benign Het
Brox T C 1: 183,064,072 (GRCm39) K245R probably damaging Het
Ccdc146 A T 5: 21,524,577 (GRCm39) S258R possibly damaging Het
Ccdc169 A C 3: 55,047,562 (GRCm39) K18Q probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Crot C A 5: 9,019,120 (GRCm39) E478* probably null Het
Dgkq A T 5: 108,802,236 (GRCm39) M443K probably damaging Het
Dhx32 A T 7: 133,339,057 (GRCm39) L326Q probably damaging Het
Dtwd1 A G 2: 126,000,342 (GRCm39) I93V probably benign Het
Ehmt2 C T 17: 35,118,357 (GRCm39) T44I probably benign Het
Enc1 T C 13: 97,381,765 (GRCm39) S92P probably benign Het
Epha5 T C 5: 84,479,051 (GRCm39) probably benign Het
Eya4 T A 10: 23,031,892 (GRCm39) S244C probably damaging Het
Fmnl3 G A 15: 99,223,791 (GRCm39) R302W probably damaging Het
Fscn3 A T 6: 28,436,173 (GRCm39) I490F possibly damaging Het
Galntl6 A G 8: 58,415,436 (GRCm39) V239A probably benign Het
Glg1 T C 8: 111,892,323 (GRCm39) I841V possibly damaging Het
Gm15455 T C 1: 33,876,893 (GRCm39) noncoding transcript Het
Gpd1l C T 9: 114,743,473 (GRCm39) M142I probably benign Het
Helb A G 10: 119,927,653 (GRCm39) V819A possibly damaging Het
Hnrnpul2 T G 19: 8,802,255 (GRCm39) F374C probably damaging Het
Hoxc10 G A 15: 102,875,753 (GRCm39) S154N possibly damaging Het
Ice2 A T 9: 69,319,651 (GRCm39) T367S possibly damaging Het
Iqca1 A T 1: 90,067,819 (GRCm39) probably null Het
Itgb4 C T 11: 115,874,983 (GRCm39) R447W probably benign Het
Klhl14 T A 18: 21,784,677 (GRCm39) H250L probably damaging Het
Kmt2c A T 5: 25,535,801 (GRCm39) D1447E probably benign Het
Larp1 G T 11: 57,940,765 (GRCm39) M630I probably benign Het
Lrp2 A G 2: 69,326,667 (GRCm39) probably null Het
Map4k3 G T 17: 80,911,427 (GRCm39) Q673K probably benign Het
Mettl16 A G 11: 74,686,823 (GRCm39) N201D possibly damaging Het
Mrpl15 C A 1: 4,855,956 (GRCm39) probably benign Het
Mthfd1l T A 10: 3,998,222 (GRCm39) V655D probably damaging Het
Odf1 T C 15: 38,226,531 (GRCm39) Y144H probably damaging Het
Or2f1b G T 6: 42,739,493 (GRCm39) C169F probably damaging Het
Or5t5 G T 2: 86,616,571 (GRCm39) V166L probably benign Het
Padi1 T C 4: 140,542,140 (GRCm39) Y594C probably damaging Het
Palm3 T A 8: 84,756,049 (GRCm39) D520E probably benign Het
Paox G A 7: 139,707,567 (GRCm39) C130Y probably damaging Het
Parpbp T A 10: 87,975,769 (GRCm39) S115C probably damaging Het
Pcnx3 A G 19: 5,721,708 (GRCm39) V1438A possibly damaging Het
Pi4ka A G 16: 17,121,006 (GRCm39) F53L probably damaging Het
Pik3c2a A T 7: 115,967,419 (GRCm39) D839E probably damaging Het
Pou2f1 T C 1: 165,710,625 (GRCm39) probably benign Het
Ppl A T 16: 4,906,492 (GRCm39) Y1268N probably benign Het
Prelid3a C T 18: 67,598,011 (GRCm39) S6L probably benign Het
Ptk2 T G 15: 73,175,682 (GRCm39) D285A possibly damaging Het
Rasd2 T G 8: 75,948,811 (GRCm39) Y246D probably damaging Het
Rhbdl2 A G 4: 123,708,120 (GRCm39) T110A probably benign Het
Rhobtb1 T A 10: 69,106,085 (GRCm39) F217I probably damaging Het
Serhl T C 15: 82,987,237 (GRCm39) probably benign Het
Sh3tc2 A G 18: 62,123,078 (GRCm39) E613G probably damaging Het
Slc26a3 A G 12: 31,502,714 (GRCm39) probably benign Het
Steap4 T C 5: 8,025,769 (GRCm39) I110T probably benign Het
Syde1 C A 10: 78,425,150 (GRCm39) R287L possibly damaging Het
Tmem184c C T 8: 78,325,291 (GRCm39) probably null Het
Trmt44 C A 5: 35,730,032 (GRCm39) probably benign Het
Ttbk2 G T 2: 120,603,764 (GRCm39) S256R probably benign Het
Ttll6 A T 11: 96,036,336 (GRCm39) I322F probably damaging Het
Ubap2 A T 4: 41,205,753 (GRCm39) probably null Het
Wsb2 A T 5: 117,515,600 (GRCm39) T402S probably damaging Het
Other mutations in Pdlim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Pdlim2 APN 14 70,403,532 (GRCm39) splice site probably benign
IGL02338:Pdlim2 APN 14 70,411,906 (GRCm39) missense probably damaging 1.00
IGL03286:Pdlim2 APN 14 70,411,925 (GRCm39) missense possibly damaging 0.88
PIT4504001:Pdlim2 UTSW 14 70,403,579 (GRCm39) missense probably benign 0.44
R0751:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0768:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0832:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1167:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1343:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1412:Pdlim2 UTSW 14 70,411,773 (GRCm39) splice site probably benign
R1595:Pdlim2 UTSW 14 70,402,193 (GRCm39) missense probably damaging 1.00
R1689:Pdlim2 UTSW 14 70,408,688 (GRCm39) missense probably damaging 0.98
R1703:Pdlim2 UTSW 14 70,411,784 (GRCm39) critical splice donor site probably null
R1843:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1845:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1923:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1924:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1925:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2004:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2005:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2202:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2205:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2237:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign 0.05
R2843:Pdlim2 UTSW 14 70,403,549 (GRCm39) missense probably benign 0.02
R4042:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R4965:Pdlim2 UTSW 14 70,405,464 (GRCm39) unclassified probably benign
R4971:Pdlim2 UTSW 14 70,405,208 (GRCm39) missense probably damaging 1.00
R6252:Pdlim2 UTSW 14 70,405,137 (GRCm39) missense probably damaging 1.00
R7208:Pdlim2 UTSW 14 70,411,826 (GRCm39) missense probably damaging 1.00
R7597:Pdlim2 UTSW 14 70,403,645 (GRCm39) missense possibly damaging 0.58
R7627:Pdlim2 UTSW 14 70,408,924 (GRCm39) missense probably benign
R8342:Pdlim2 UTSW 14 70,403,563 (GRCm39) missense probably damaging 1.00
R8554:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign
R9361:Pdlim2 UTSW 14 70,402,190 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCATGGATCCTTAAGCTAC -3'
(R):5'- AGGTTCAGGTACTAGCAGGTC -3'

Sequencing Primer
(F):5'- CTGTTTGGCCTCATTCCAGAGAG -3'
(R):5'- CTTGCAGAGTTGGGTGAGCTC -3'
Posted On 2017-03-31