Incidental Mutation 'R5951:Pdlim2'
ID470912
Institutional Source Beutler Lab
Gene Symbol Pdlim2
Ensembl Gene ENSMUSG00000022090
Gene NamePDZ and LIM domain 2
SynonymsSLIM, 4732462F18Rik, mystique
MMRRC Submission 044141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5951 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location70164218-70177681 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70167780 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 212 (D212V)
Ref Sequence ENSEMBL: ENSMUSP00000119222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000143393] [ENSMUST00000153735]
Predicted Effect probably benign
Transcript: ENSMUST00000022681
AA Change: D212V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: D212V

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123125
Predicted Effect unknown
Transcript: ENSMUST00000125300
AA Change: D13V
SMART Domains Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090
AA Change: D13V

DomainStartEndE-ValueType
Pfam:DUF4749 7 58 6.4e-13 PFAM
low complexity region 61 73 N/A INTRINSIC
LIM 84 136 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127836
SMART Domains Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129174
SMART Domains Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Predicted Effect probably benign
Transcript: ENSMUST00000143393
AA Change: D212V

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090
AA Change: D212V

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153735
AA Change: D212V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: D212V

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,799 E180D probably damaging Het
Add3 A G 19: 53,244,289 probably null Het
Adgrv1 A T 13: 81,442,501 I4396N probably damaging Het
Apc C T 18: 34,317,146 S2331L possibly damaging Het
Apoh G T 11: 108,395,903 C51F probably damaging Het
Arid4b T C 13: 14,143,063 V177A possibly damaging Het
Atp13a1 T A 8: 69,797,285 I343N probably damaging Het
Bcar1 T C 8: 111,713,400 D654G probably benign Het
Brox T C 1: 183,282,508 K245R probably damaging Het
Ccdc146 A T 5: 21,319,579 S258R possibly damaging Het
Ccdc169 A C 3: 55,140,141 K18Q probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Crot C A 5: 8,969,120 E478* probably null Het
Dgkq A T 5: 108,654,370 M443K probably damaging Het
Dhx32 A T 7: 133,737,328 L326Q probably damaging Het
Dtwd1 A G 2: 126,158,422 I93V probably benign Het
Ehmt2 C T 17: 34,899,381 T44I probably benign Het
Enc1 T C 13: 97,245,257 S92P probably benign Het
Epha5 T C 5: 84,331,192 probably benign Het
Eya4 T A 10: 23,155,994 S244C probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Fscn3 A T 6: 28,436,174 I490F possibly damaging Het
Galntl6 A G 8: 57,962,402 V239A probably benign Het
Glg1 T C 8: 111,165,691 I841V possibly damaging Het
Gm15455 T C 1: 33,837,812 noncoding transcript Het
Gpd1l C T 9: 114,914,405 M142I probably benign Het
Helb A G 10: 120,091,748 V819A possibly damaging Het
Hnrnpul2 T G 19: 8,824,891 F374C probably damaging Het
Hoxc10 G A 15: 102,967,318 S154N possibly damaging Het
Ice2 A T 9: 69,412,369 T367S possibly damaging Het
Iqca A T 1: 90,140,097 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Kmt2c A T 5: 25,330,803 D1447E probably benign Het
Larp1 G T 11: 58,049,939 M630I probably benign Het
Lrp2 A G 2: 69,496,323 probably null Het
Map4k3 G T 17: 80,603,998 Q673K probably benign Het
Mettl16 A G 11: 74,795,997 N201D possibly damaging Het
Mrpl15 C A 1: 4,785,733 probably benign Het
Mthfd1l T A 10: 4,048,222 V655D probably damaging Het
Odf1 T C 15: 38,226,287 Y144H probably damaging Het
Olfr1093 G T 2: 86,786,227 V166L probably benign Het
Olfr38 G T 6: 42,762,559 C169F probably damaging Het
Padi1 T C 4: 140,814,829 Y594C probably damaging Het
Palm3 T A 8: 84,029,420 D520E probably benign Het
Paox G A 7: 140,127,654 C130Y probably damaging Het
Parpbp T A 10: 88,139,907 S115C probably damaging Het
Pcnx3 A G 19: 5,671,680 V1438A possibly damaging Het
Pi4ka A G 16: 17,303,142 F53L probably damaging Het
Pik3c2a A T 7: 116,368,184 D839E probably damaging Het
Pou2f1 T C 1: 165,883,056 probably benign Het
Ppl A T 16: 5,088,628 Y1268N probably benign Het
Prelid3a C T 18: 67,464,941 S6L probably benign Het
Ptk2 T G 15: 73,303,833 D285A possibly damaging Het
Rasd2 T G 8: 75,222,183 Y246D probably damaging Het
Rhbdl2 A G 4: 123,814,327 T110A probably benign Het
Rhobtb1 T A 10: 69,270,255 F217I probably damaging Het
Serhl T C 15: 83,103,036 probably benign Het
Sh3tc2 A G 18: 61,990,007 E613G probably damaging Het
Slc26a3 A G 12: 31,452,715 probably benign Het
Steap4 T C 5: 7,975,769 I110T probably benign Het
Syde1 C A 10: 78,589,316 R287L possibly damaging Het
Tmem184c C T 8: 77,598,662 probably null Het
Trmt44 C A 5: 35,572,688 probably benign Het
Ttbk2 G T 2: 120,773,283 S256R probably benign Het
Ttll6 A T 11: 96,145,510 I322F probably damaging Het
Ubap2 A T 4: 41,205,753 probably null Het
Wsb2 A T 5: 117,377,535 T402S probably damaging Het
Other mutations in Pdlim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Pdlim2 APN 14 70166083 splice site probably benign
IGL02338:Pdlim2 APN 14 70174457 missense probably damaging 1.00
IGL03286:Pdlim2 APN 14 70174476 missense possibly damaging 0.88
PIT4504001:Pdlim2 UTSW 14 70166130 missense probably benign 0.44
R0751:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R0768:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R0832:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1167:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1343:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1412:Pdlim2 UTSW 14 70174324 splice site probably benign
R1595:Pdlim2 UTSW 14 70164744 missense probably damaging 1.00
R1689:Pdlim2 UTSW 14 70171239 missense probably damaging 0.98
R1703:Pdlim2 UTSW 14 70174335 critical splice donor site probably null
R1843:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1845:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1923:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1924:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1925:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2004:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2005:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2202:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2205:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2237:Pdlim2 UTSW 14 70171249 missense probably benign 0.05
R2843:Pdlim2 UTSW 14 70166100 missense probably benign 0.02
R4042:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R4965:Pdlim2 UTSW 14 70168015 unclassified probably benign
R4971:Pdlim2 UTSW 14 70167759 missense probably damaging 1.00
R6252:Pdlim2 UTSW 14 70167688 missense probably damaging 1.00
R7208:Pdlim2 UTSW 14 70174377 missense probably damaging 1.00
R7597:Pdlim2 UTSW 14 70166196 missense possibly damaging 0.58
R7627:Pdlim2 UTSW 14 70171475 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCATGGATCCTTAAGCTAC -3'
(R):5'- AGGTTCAGGTACTAGCAGGTC -3'

Sequencing Primer
(F):5'- CTGTTTGGCCTCATTCCAGAGAG -3'
(R):5'- CTTGCAGAGTTGGGTGAGCTC -3'
Posted On2017-03-31