Mutagenetix > Incidental Mutation

Incidental Mutation 'R5951:Ptk2'

470914

Institutional Source

Beutler Lab

Gene Symbol

Ptk2

Ensembl Gene

ENSMUSG00000022607

Gene Name

PTK2 protein tyrosine kinase 2

Synonyms

FRNK, FAK, Fadk

MMRRC Submission

044141-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5951 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

73205102-73423280 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 73303833 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 285 (D285A)

Ref Sequence

ENSEMBL: ENSMUSP00000154242 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000170939] [ENSMUST00000226791] [ENSMUST00000226988]

AlphaFold

P34152

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110036
AA Change: D285A

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: D285A

Domain	Start	End	E-Value	Type
B41	31	258	1.49e-39	SMART
Blast:B41	288	333	1e-19	BLAST
TyrKc	422	676	1.11e-130	SMART
low complexity region	686	698	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC
low complexity region	863	883	N/A	INTRINSIC
Pfam:Focal_AT	914	1046	5e-59	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000170939
AA Change: D285A

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126764
Gene: ENSMUSG00000022607
AA Change: D285A

Domain	Start	End	E-Value	Type
B41	31	258	1.49e-39	SMART
Blast:B41	287	333	1e-19	BLAST
TyrKc	422	676	1.11e-130	SMART
low complexity region	686	698	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC
low complexity region	863	883	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226742

Predicted Effect

probably benign
Transcript: ENSMUST00000226791

Predicted Effect

possibly damaging
Transcript: ENSMUST00000226988
AA Change: D285A

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227569

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228628

Meta Mutation Damage Score

0.1420

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	A	2: 35,354,799	E180D	probably damaging	Het
Add3	A	G	19: 53,244,289		probably null	Het
Adgrv1	A	T	13: 81,442,501	I4396N	probably damaging	Het
Apc	C	T	18: 34,317,146	S2331L	possibly damaging	Het
Apoh	G	T	11: 108,395,903	C51F	probably damaging	Het
Arid4b	T	C	13: 14,143,063	V177A	possibly damaging	Het
Atp13a1	T	A	8: 69,797,285	I343N	probably damaging	Het
Bcar1	T	C	8: 111,713,400	D654G	probably benign	Het
Brox	T	C	1: 183,282,508	K245R	probably damaging	Het
Ccdc146	A	T	5: 21,319,579	S258R	possibly damaging	Het
Ccdc169	A	C	3: 55,140,141	K18Q	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Crot	C	A	5: 8,969,120	E478*	probably null	Het
Dgkq	A	T	5: 108,654,370	M443K	probably damaging	Het
Dhx32	A	T	7: 133,737,328	L326Q	probably damaging	Het
Dtwd1	A	G	2: 126,158,422	I93V	probably benign	Het
Ehmt2	C	T	17: 34,899,381	T44I	probably benign	Het
Enc1	T	C	13: 97,245,257	S92P	probably benign	Het
Epha5	T	C	5: 84,331,192		probably benign	Het
Eya4	T	A	10: 23,155,994	S244C	probably damaging	Het
Fmnl3	G	A	15: 99,325,910	R302W	probably damaging	Het
Fscn3	A	T	6: 28,436,174	I490F	possibly damaging	Het
Galntl6	A	G	8: 57,962,402	V239A	probably benign	Het
Glg1	T	C	8: 111,165,691	I841V	possibly damaging	Het
Gm15455	T	C	1: 33,837,812		noncoding transcript	Het
Gpd1l	C	T	9: 114,914,405	M142I	probably benign	Het
Helb	A	G	10: 120,091,748	V819A	possibly damaging	Het
Hnrnpul2	T	G	19: 8,824,891	F374C	probably damaging	Het
Hoxc10	G	A	15: 102,967,318	S154N	possibly damaging	Het
Ice2	A	T	9: 69,412,369	T367S	possibly damaging	Het
Iqca	A	T	1: 90,140,097		probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Klhl14	T	A	18: 21,651,620	H250L	probably damaging	Het
Kmt2c	A	T	5: 25,330,803	D1447E	probably benign	Het
Larp1	G	T	11: 58,049,939	M630I	probably benign	Het
Lrp2	A	G	2: 69,496,323		probably null	Het
Map4k3	G	T	17: 80,603,998	Q673K	probably benign	Het
Mettl16	A	G	11: 74,795,997	N201D	possibly damaging	Het
Mrpl15	C	A	1: 4,785,733		probably benign	Het
Mthfd1l	T	A	10: 4,048,222	V655D	probably damaging	Het
Odf1	T	C	15: 38,226,287	Y144H	probably damaging	Het
Olfr1093	G	T	2: 86,786,227	V166L	probably benign	Het
Olfr38	G	T	6: 42,762,559	C169F	probably damaging	Het
Padi1	T	C	4: 140,814,829	Y594C	probably damaging	Het
Palm3	T	A	8: 84,029,420	D520E	probably benign	Het
Paox	G	A	7: 140,127,654	C130Y	probably damaging	Het
Parpbp	T	A	10: 88,139,907	S115C	probably damaging	Het
Pcnx3	A	G	19: 5,671,680	V1438A	possibly damaging	Het
Pdlim2	T	A	14: 70,167,780	D212V	probably benign	Het
Pi4ka	A	G	16: 17,303,142	F53L	probably damaging	Het
Pik3c2a	A	T	7: 116,368,184	D839E	probably damaging	Het
Pou2f1	T	C	1: 165,883,056		probably benign	Het
Ppl	A	T	16: 5,088,628	Y1268N	probably benign	Het
Prelid3a	C	T	18: 67,464,941	S6L	probably benign	Het
Rasd2	T	G	8: 75,222,183	Y246D	probably damaging	Het
Rhbdl2	A	G	4: 123,814,327	T110A	probably benign	Het
Rhobtb1	T	A	10: 69,270,255	F217I	probably damaging	Het
Serhl	T	C	15: 83,103,036		probably benign	Het
Sh3tc2	A	G	18: 61,990,007	E613G	probably damaging	Het
Slc26a3	A	G	12: 31,452,715		probably benign	Het
Steap4	T	C	5: 7,975,769	I110T	probably benign	Het
Syde1	C	A	10: 78,589,316	R287L	possibly damaging	Het
Tmem184c	C	T	8: 77,598,662		probably null	Het
Trmt44	C	A	5: 35,572,688		probably benign	Het
Ttbk2	G	T	2: 120,773,283	S256R	probably benign	Het
Ttll6	A	T	11: 96,145,510	I322F	probably damaging	Het
Ubap2	A	T	4: 41,205,753		probably null	Het
Wsb2	A	T	5: 117,377,535	T402S	probably damaging	Het

Other mutations in Ptk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Ptk2	APN	15	73262547	missense	probably damaging	1.00
IGL00913:Ptk2	APN	15	73295389	splice site	probably benign
IGL01605:Ptk2	APN	15	73264339	splice site	probably benign
IGL01631:Ptk2	APN	15	73216371	missense	probably damaging	1.00
IGL01952:Ptk2	APN	15	73229931	missense	probably damaging	0.99
IGL01957:Ptk2	APN	15	73242473	missense	probably benign	0.05
IGL02441:Ptk2	APN	15	73320826	missense	probably benign	0.16
IGL02471:Ptk2	APN	15	73298187	missense	probably benign	0.41
IGL02621:Ptk2	APN	15	73206145	missense	probably damaging	0.99
IGL03198:Ptk2	APN	15	73236216	missense	probably damaging	1.00
Shooter	UTSW	15	73304444	missense	possibly damaging	0.83
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R1254:Ptk2	UTSW	15	73229970	missense	probably benign	0.01
R1291:Ptk2	UTSW	15	73210756	missense	probably damaging	1.00
R1307:Ptk2	UTSW	15	73292046	missense	probably benign	0.01
R1608:Ptk2	UTSW	15	73262575	missense	probably damaging	0.98
R1690:Ptk2	UTSW	15	73262610	missense	probably damaging	1.00
R1724:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1725:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1740:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1741:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1840:Ptk2	UTSW	15	73210884	missense	probably damaging	1.00
R1956:Ptk2	UTSW	15	73215983	missense	possibly damaging	0.49
R2022:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2092:Ptk2	UTSW	15	73236191	nonsense	probably null
R2114:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2115:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2336:Ptk2	UTSW	15	73266116	missense	probably damaging	1.00
R2571:Ptk2	UTSW	15	73231919	missense	probably damaging	1.00
R4232:Ptk2	UTSW	15	73309849	missense	possibly damaging	0.61
R4245:Ptk2	UTSW	15	73231976	missense	probably benign	0.00
R4594:Ptk2	UTSW	15	73206196	missense	probably damaging	1.00
R4688:Ptk2	UTSW	15	73206225	missense	probably damaging	1.00
R4834:Ptk2	UTSW	15	73216096	splice site	probably null
R4847:Ptk2	UTSW	15	73231956	missense	probably benign
R5558:Ptk2	UTSW	15	73304445	missense	probably damaging	0.97
R5682:Ptk2	UTSW	15	73262564	nonsense	probably null
R5858:Ptk2	UTSW	15	73321095	missense	probably benign	0.12
R6014:Ptk2	UTSW	15	73304444	missense	possibly damaging	0.83
R6027:Ptk2	UTSW	15	73229913	missense	probably damaging	1.00
R6082:Ptk2	UTSW	15	73276865	missense	probably damaging	1.00
R7025:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7031:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7032:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7077:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7078:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7079:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7090:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7091:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7092:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7136:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7137:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7798:Ptk2	UTSW	15	73295375	missense	probably damaging	1.00
R8057:Ptk2	UTSW	15	73298199	frame shift	probably null
R8235:Ptk2	UTSW	15	73343291	missense	probably benign	0.00
R9106:Ptk2	UTSW	15	73259608	missense	possibly damaging	0.95
R9160:Ptk2	UTSW	15	73216084	missense	probably benign	0.01
R9301:Ptk2	UTSW	15	73274497	missense	probably damaging	1.00
R9448:Ptk2	UTSW	15	73343192	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- AAGGTGTAAGTTTAAGCATCTCCC -3'
(R):5'- TCAGGCTCAGTAGTTCCTGG -3'

Sequencing Primer
(F):5'- GTAAGTTTAAGCATCTCCCACACAAC -3'
(R):5'- CTCAGTAGTTCCTGGGTCATTG -3'

Posted On

2017-03-31