Incidental Mutation 'R5951:Serhl'
ID470915
Institutional Source Beutler Lab
Gene Symbol Serhl
Ensembl Gene ENSMUSG00000058586
Gene Nameserine hydrolase-like
Synonyms1110019M09Rik
MMRRC Submission 044141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5951 (G1)
Quality Score175
Status Validated
Chromosome15
Chromosomal Location83089506-83116674 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 83103036 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000078218] [ENSMUST00000166427] [ENSMUST00000167389] [ENSMUST00000167862] [ENSMUST00000168029]
Predicted Effect probably benign
Transcript: ENSMUST00000078218
SMART Domains Protein: ENSMUSP00000077345
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 28 282 1.4e-10 PFAM
Pfam:Abhydrolase_6 29 295 2.9e-28 PFAM
Pfam:Abhydrolase_1 53 260 1.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165371
Predicted Effect probably benign
Transcript: ENSMUST00000166427
SMART Domains Protein: ENSMUSP00000132686
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Hydrolase_4 33 194 7.4e-11 PFAM
Pfam:Abhydrolase_1 37 299 4e-20 PFAM
Pfam:Abhydrolase_5 38 292 4.4e-10 PFAM
Pfam:Abhydrolase_6 39 305 6.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167389
SMART Domains Protein: ENSMUSP00000128251
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_6 2 54 4.3e-8 PFAM
Pfam:Abhydrolase_1 3 54 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167750
Predicted Effect probably benign
Transcript: ENSMUST00000167862
Predicted Effect probably benign
Transcript: ENSMUST00000168029
SMART Domains Protein: ENSMUSP00000128802
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_1 1 96 3.3e-15 PFAM
Pfam:Abhydrolase_6 1 97 2.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169702
Predicted Effect probably benign
Transcript: ENSMUST00000169814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172101
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,799 E180D probably damaging Het
Add3 A G 19: 53,244,289 probably null Het
Adgrv1 A T 13: 81,442,501 I4396N probably damaging Het
Apc C T 18: 34,317,146 S2331L possibly damaging Het
Apoh G T 11: 108,395,903 C51F probably damaging Het
Arid4b T C 13: 14,143,063 V177A possibly damaging Het
Atp13a1 T A 8: 69,797,285 I343N probably damaging Het
Bcar1 T C 8: 111,713,400 D654G probably benign Het
Brox T C 1: 183,282,508 K245R probably damaging Het
Ccdc146 A T 5: 21,319,579 S258R possibly damaging Het
Ccdc169 A C 3: 55,140,141 K18Q probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Crot C A 5: 8,969,120 E478* probably null Het
Dgkq A T 5: 108,654,370 M443K probably damaging Het
Dhx32 A T 7: 133,737,328 L326Q probably damaging Het
Dtwd1 A G 2: 126,158,422 I93V probably benign Het
Ehmt2 C T 17: 34,899,381 T44I probably benign Het
Enc1 T C 13: 97,245,257 S92P probably benign Het
Epha5 T C 5: 84,331,192 probably benign Het
Eya4 T A 10: 23,155,994 S244C probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Fscn3 A T 6: 28,436,174 I490F possibly damaging Het
Galntl6 A G 8: 57,962,402 V239A probably benign Het
Glg1 T C 8: 111,165,691 I841V possibly damaging Het
Gm15455 T C 1: 33,837,812 noncoding transcript Het
Gpd1l C T 9: 114,914,405 M142I probably benign Het
Helb A G 10: 120,091,748 V819A possibly damaging Het
Hnrnpul2 T G 19: 8,824,891 F374C probably damaging Het
Hoxc10 G A 15: 102,967,318 S154N possibly damaging Het
Ice2 A T 9: 69,412,369 T367S possibly damaging Het
Iqca A T 1: 90,140,097 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Kmt2c A T 5: 25,330,803 D1447E probably benign Het
Larp1 G T 11: 58,049,939 M630I probably benign Het
Lrp2 A G 2: 69,496,323 probably null Het
Map4k3 G T 17: 80,603,998 Q673K probably benign Het
Mettl16 A G 11: 74,795,997 N201D possibly damaging Het
Mrpl15 C A 1: 4,785,733 probably benign Het
Mthfd1l T A 10: 4,048,222 V655D probably damaging Het
Odf1 T C 15: 38,226,287 Y144H probably damaging Het
Olfr1093 G T 2: 86,786,227 V166L probably benign Het
Olfr38 G T 6: 42,762,559 C169F probably damaging Het
Padi1 T C 4: 140,814,829 Y594C probably damaging Het
Palm3 T A 8: 84,029,420 D520E probably benign Het
Paox G A 7: 140,127,654 C130Y probably damaging Het
Parpbp T A 10: 88,139,907 S115C probably damaging Het
Pcnx3 A G 19: 5,671,680 V1438A possibly damaging Het
Pdlim2 T A 14: 70,167,780 D212V probably benign Het
Pi4ka A G 16: 17,303,142 F53L probably damaging Het
Pik3c2a A T 7: 116,368,184 D839E probably damaging Het
Pou2f1 T C 1: 165,883,056 probably benign Het
Ppl A T 16: 5,088,628 Y1268N probably benign Het
Prelid3a C T 18: 67,464,941 S6L probably benign Het
Ptk2 T G 15: 73,303,833 D285A possibly damaging Het
Rasd2 T G 8: 75,222,183 Y246D probably damaging Het
Rhbdl2 A G 4: 123,814,327 T110A probably benign Het
Rhobtb1 T A 10: 69,270,255 F217I probably damaging Het
Sh3tc2 A G 18: 61,990,007 E613G probably damaging Het
Slc26a3 A G 12: 31,452,715 probably benign Het
Steap4 T C 5: 7,975,769 I110T probably benign Het
Syde1 C A 10: 78,589,316 R287L possibly damaging Het
Tmem184c C T 8: 77,598,662 probably null Het
Trmt44 C A 5: 35,572,688 probably benign Het
Ttbk2 G T 2: 120,773,283 S256R probably benign Het
Ttll6 A T 11: 96,145,510 I322F probably damaging Het
Ubap2 A T 4: 41,205,753 probably null Het
Wsb2 A T 5: 117,377,535 T402S probably damaging Het
Other mutations in Serhl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Serhl APN 15 83104373 missense probably benign 0.15
IGL00425:Serhl APN 15 83105637 missense possibly damaging 0.79
R1544:Serhl UTSW 15 83105676 missense probably damaging 1.00
R2119:Serhl UTSW 15 83115575 missense probably benign 0.19
R2320:Serhl UTSW 15 83101872 missense probably damaging 0.99
R3236:Serhl UTSW 15 83104403 missense probably damaging 0.96
R5156:Serhl UTSW 15 83102694 unclassified probably benign
R5256:Serhl UTSW 15 83102634 missense probably damaging 1.00
R5822:Serhl UTSW 15 83116327 missense probably benign 0.02
R6385:Serhl UTSW 15 83101622 missense probably benign
R6521:Serhl UTSW 15 83101642 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGTTCTGGTGAAATCTGTGCC -3'
(R):5'- GATCCACCAGCTTTCTGCAG -3'

Sequencing Primer
(F):5'- GGTGAAATCTGTGCCTTCCC -3'
(R):5'- AGCTTTCTGCAGAATCCAGG -3'
Posted On2017-03-31