Incidental Mutation 'R5951:Fmnl3'
ID470916
Institutional Source Beutler Lab
Gene Symbol Fmnl3
Ensembl Gene ENSMUSG00000023008
Gene Nameformin-like 3
SynonymsWbp3, 2700073B04Rik
MMRRC Submission 044141-MU
Accession Numbers

Genbank: NM_011711; MGI: 109569  

Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R5951 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location99317225-99370482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99325910 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 302 (R302W)
Ref Sequence ENSEMBL: ENSMUSP00000085566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081224] [ENSMUST00000088233] [ENSMUST00000120633]
Predicted Effect probably damaging
Transcript: ENSMUST00000081224
AA Change: R251W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079984
Gene: ENSMUSG00000023008
AA Change: R251W

DomainStartEndE-ValueType
Drf_GBD 26 227 2.99e-88 SMART
Drf_FH3 230 421 6.1e-71 SMART
low complexity region 448 497 N/A INTRINSIC
FH2 510 944 9.85e-141 SMART
low complexity region 960 975 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000088233
AA Change: R302W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085566
Gene: ENSMUSG00000023008
AA Change: R302W

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120633
AA Change: R302W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113094
Gene: ENSMUSG00000023008
AA Change: R302W

DomainStartEndE-ValueType
Drf_GBD 26 278 3.91e-92 SMART
Drf_FH3 281 472 6.1e-71 SMART
low complexity region 499 548 N/A INTRINSIC
FH2 561 995 9.85e-141 SMART
low complexity region 1011 1026 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140368
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a formin homology 2 domain and has high sequence identity to the mouse Wbp3 protein. Two alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,799 E180D probably damaging Het
Add3 A G 19: 53,244,289 probably null Het
Adgrv1 A T 13: 81,442,501 I4396N probably damaging Het
Apc C T 18: 34,317,146 S2331L possibly damaging Het
Apoh G T 11: 108,395,903 C51F probably damaging Het
Arid4b T C 13: 14,143,063 V177A possibly damaging Het
Atp13a1 T A 8: 69,797,285 I343N probably damaging Het
Bcar1 T C 8: 111,713,400 D654G probably benign Het
Brox T C 1: 183,282,508 K245R probably damaging Het
Ccdc146 A T 5: 21,319,579 S258R possibly damaging Het
Ccdc169 A C 3: 55,140,141 K18Q probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Crot C A 5: 8,969,120 E478* probably null Het
Dgkq A T 5: 108,654,370 M443K probably damaging Het
Dhx32 A T 7: 133,737,328 L326Q probably damaging Het
Dtwd1 A G 2: 126,158,422 I93V probably benign Het
Ehmt2 C T 17: 34,899,381 T44I probably benign Het
Enc1 T C 13: 97,245,257 S92P probably benign Het
Epha5 T C 5: 84,331,192 probably benign Het
Eya4 T A 10: 23,155,994 S244C probably damaging Het
Fscn3 A T 6: 28,436,174 I490F possibly damaging Het
Galntl6 A G 8: 57,962,402 V239A probably benign Het
Glg1 T C 8: 111,165,691 I841V possibly damaging Het
Gm15455 T C 1: 33,837,812 noncoding transcript Het
Gpd1l C T 9: 114,914,405 M142I probably benign Het
Helb A G 10: 120,091,748 V819A possibly damaging Het
Hnrnpul2 T G 19: 8,824,891 F374C probably damaging Het
Hoxc10 G A 15: 102,967,318 S154N possibly damaging Het
Ice2 A T 9: 69,412,369 T367S possibly damaging Het
Iqca A T 1: 90,140,097 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Kmt2c A T 5: 25,330,803 D1447E probably benign Het
Larp1 G T 11: 58,049,939 M630I probably benign Het
Lrp2 A G 2: 69,496,323 probably null Het
Map4k3 G T 17: 80,603,998 Q673K probably benign Het
Mettl16 A G 11: 74,795,997 N201D possibly damaging Het
Mrpl15 C A 1: 4,785,733 probably benign Het
Mthfd1l T A 10: 4,048,222 V655D probably damaging Het
Odf1 T C 15: 38,226,287 Y144H probably damaging Het
Olfr1093 G T 2: 86,786,227 V166L probably benign Het
Olfr38 G T 6: 42,762,559 C169F probably damaging Het
Padi1 T C 4: 140,814,829 Y594C probably damaging Het
Palm3 T A 8: 84,029,420 D520E probably benign Het
Paox G A 7: 140,127,654 C130Y probably damaging Het
Parpbp T A 10: 88,139,907 S115C probably damaging Het
Pcnx3 A G 19: 5,671,680 V1438A possibly damaging Het
Pdlim2 T A 14: 70,167,780 D212V probably benign Het
Pi4ka A G 16: 17,303,142 F53L probably damaging Het
Pik3c2a A T 7: 116,368,184 D839E probably damaging Het
Pou2f1 T C 1: 165,883,056 probably benign Het
Ppl A T 16: 5,088,628 Y1268N probably benign Het
Prelid3a C T 18: 67,464,941 S6L probably benign Het
Ptk2 T G 15: 73,303,833 D285A possibly damaging Het
Rasd2 T G 8: 75,222,183 Y246D probably damaging Het
Rhbdl2 A G 4: 123,814,327 T110A probably benign Het
Rhobtb1 T A 10: 69,270,255 F217I probably damaging Het
Serhl T C 15: 83,103,036 probably benign Het
Sh3tc2 A G 18: 61,990,007 E613G probably damaging Het
Slc26a3 A G 12: 31,452,715 probably benign Het
Steap4 T C 5: 7,975,769 I110T probably benign Het
Syde1 C A 10: 78,589,316 R287L possibly damaging Het
Tmem184c C T 8: 77,598,662 probably null Het
Trmt44 C A 5: 35,572,688 probably benign Het
Ttbk2 G T 2: 120,773,283 S256R probably benign Het
Ttll6 A T 11: 96,145,510 I322F probably damaging Het
Ubap2 A T 4: 41,205,753 probably null Het
Wsb2 A T 5: 117,377,535 T402S probably damaging Het
Other mutations in Fmnl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00648:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00672:Fmnl3 APN 15 99325681 missense probably damaging 1.00
IGL00727:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00754:Fmnl3 APN 15 99322670 missense probably damaging 1.00
IGL00927:Fmnl3 APN 15 99337628 critical splice donor site probably null
IGL02376:Fmnl3 APN 15 99318963 missense possibly damaging 0.51
IGL02607:Fmnl3 APN 15 99324772 missense probably damaging 1.00
IGL03323:Fmnl3 APN 15 99321281 missense probably damaging 1.00
C9142:Fmnl3 UTSW 15 99337627 splice site probably null
PIT4280001:Fmnl3 UTSW 15 99321253 critical splice donor site probably null
R0003:Fmnl3 UTSW 15 99321132 missense probably damaging 0.99
R0003:Fmnl3 UTSW 15 99321132 missense probably damaging 0.99
R0116:Fmnl3 UTSW 15 99322738 splice site probably benign
R0117:Fmnl3 UTSW 15 99322738 splice site probably benign
R0137:Fmnl3 UTSW 15 99322738 splice site probably benign
R0138:Fmnl3 UTSW 15 99322738 splice site probably benign
R0701:Fmnl3 UTSW 15 99321307 missense probably damaging 0.99
R2338:Fmnl3 UTSW 15 99370227 missense probably benign 0.01
R3729:Fmnl3 UTSW 15 99321864 missense probably damaging 0.99
R4707:Fmnl3 UTSW 15 99323481 missense probably benign 0.00
R5346:Fmnl3 UTSW 15 99331990 missense probably damaging 1.00
R5655:Fmnl3 UTSW 15 99321862 missense probably damaging 0.99
R5916:Fmnl3 UTSW 15 99321828 missense probably damaging 0.99
R5954:Fmnl3 UTSW 15 99325910 missense probably damaging 1.00
R5957:Fmnl3 UTSW 15 99325910 missense probably damaging 1.00
R6334:Fmnl3 UTSW 15 99337653 missense probably damaging 1.00
R6891:Fmnl3 UTSW 15 99325873 missense probably damaging 1.00
R7182:Fmnl3 UTSW 15 99321782 missense probably damaging 0.99
R7423:Fmnl3 UTSW 15 99329400 missense probably damaging 0.99
X0009:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0010:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0011:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0012:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0014:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0017:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0021:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0023:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0023:Fmnl3 UTSW 15 99325284 missense probably damaging 1.00
X0028:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0033:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0060:Fmnl3 UTSW 15 99320038 missense possibly damaging 0.69
X0064:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
X0067:Fmnl3 UTSW 15 99322327 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCGAGTGCACCACAATGTTG -3'
(R):5'- CTGGTGTCCAAAATGGCACAG -3'

Sequencing Primer
(F):5'- GTGCACCACAATGTTGATGAACTG -3'
(R):5'- TGGCCTGAAACTATGGCAGTC -3'
Posted On2017-03-31