Mutagenetix > Incidental Mutations

Incidental Mutation 'R5951:Ppl'

470918

Institutional Source

Beutler Lab

Gene Symbol

Ppl

Ensembl Gene

ENSMUSG00000039457

Gene Name

periplakin

Synonyms

MMRRC Submission

044141-MU

Accession Numbers

Genbank: NM_008909

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5951 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

5086291-5132421 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 5088628 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1268 (Y1268N)

Ref Sequence

ENSEMBL: ENSMUSP00000039360 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035672] [ENSMUST00000052449] [ENSMUST00000229126] [ENSMUST00000230703]

Predicted Effect

probably benign
Transcript: ENSMUST00000035672
AA Change: Y1268N

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000039360
Gene: ENSMUSG00000039457
AA Change: Y1268N

Domain	Start	End	E-Value	Type
SPEC	123	211	1.58e0	SMART
SPEC	214	315	3.38e-2	SMART
SPEC	321	483	1.11e-2	SMART
SPEC	503	610	4.96e0	SMART
Blast:SPEC	613	717	5e-59	BLAST
low complexity region	718	729	N/A	INTRINSIC
Blast:SPEC	732	859	2e-60	BLAST
low complexity region	893	908	N/A	INTRINSIC
low complexity region	963	982	N/A	INTRINSIC
internal_repeat_2	984	1004	3.46e-5	PROSPERO
internal_repeat_1	992	1008	8.09e-7	PROSPERO
low complexity region	1011	1020	N/A	INTRINSIC
low complexity region	1027	1042	N/A	INTRINSIC
internal_repeat_1	1112	1128	8.09e-7	PROSPERO
coiled coil region	1180	1279	N/A	INTRINSIC
low complexity region	1346	1355	N/A	INTRINSIC
low complexity region	1386	1433	N/A	INTRINSIC
low complexity region	1455	1479	N/A	INTRINSIC
Blast:SPEC	1529	1610	8e-30	BLAST
low complexity region	1612	1630	N/A	INTRINSIC
PLEC	1649	1683	1.34e-5	SMART
PLEC	1698	1733	2.23e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000052449

SMART Domains

Protein: ENSMUSP00000061843
Gene: ENSMUSG00000039473

Domain	Start	End	E-Value	Type
Pfam:HUN	117	168	1.4e-22	PFAM
low complexity region	181	224	N/A	INTRINSIC
low complexity region	232	238	N/A	INTRINSIC
low complexity region	250	267	N/A	INTRINSIC
low complexity region	331	344	N/A	INTRINSIC
Pfam:UBN_AB	353	573	2.4e-80	PFAM
low complexity region	792	804	N/A	INTRINSIC
low complexity region	856	882	N/A	INTRINSIC
low complexity region	905	934	N/A	INTRINSIC
low complexity region	970	984	N/A	INTRINSIC
low complexity region	996	1006	N/A	INTRINSIC
low complexity region	1016	1034	N/A	INTRINSIC
low complexity region	1084	1098	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229126

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229386

Predicted Effect

probably benign
Transcript: ENSMUST00000230703

Meta Mutation Damage Score

0.0767

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and grossly normal with no apparent skin abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	A	2: 35,354,799	E180D	probably damaging	Het
Add3	A	G	19: 53,244,289		probably null	Het
Adgrv1	A	T	13: 81,442,501	I4396N	probably damaging	Het
Apc	C	T	18: 34,317,146	S2331L	possibly damaging	Het
Apoh	G	T	11: 108,395,903	C51F	probably damaging	Het
Arid4b	T	C	13: 14,143,063	V177A	possibly damaging	Het
Atp13a1	T	A	8: 69,797,285	I343N	probably damaging	Het
Bcar1	T	C	8: 111,713,400	D654G	probably benign	Het
Brox	T	C	1: 183,282,508	K245R	probably damaging	Het
Ccdc146	A	T	5: 21,319,579	S258R	possibly damaging	Het
Ccdc169	A	C	3: 55,140,141	K18Q	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Crot	C	A	5: 8,969,120	E478*	probably null	Het
Dgkq	A	T	5: 108,654,370	M443K	probably damaging	Het
Dhx32	A	T	7: 133,737,328	L326Q	probably damaging	Het
Dtwd1	A	G	2: 126,158,422	I93V	probably benign	Het
Ehmt2	C	T	17: 34,899,381	T44I	probably benign	Het
Enc1	T	C	13: 97,245,257	S92P	probably benign	Het
Epha5	T	C	5: 84,331,192		probably benign	Het
Eya4	T	A	10: 23,155,994	S244C	probably damaging	Het
Fmnl3	G	A	15: 99,325,910	R302W	probably damaging	Het
Fscn3	A	T	6: 28,436,174	I490F	possibly damaging	Het
Galntl6	A	G	8: 57,962,402	V239A	probably benign	Het
Glg1	T	C	8: 111,165,691	I841V	possibly damaging	Het
Gm15455	T	C	1: 33,837,812		noncoding transcript	Het
Gpd1l	C	T	9: 114,914,405	M142I	probably benign	Het
Helb	A	G	10: 120,091,748	V819A	possibly damaging	Het
Hnrnpul2	T	G	19: 8,824,891	F374C	probably damaging	Het
Hoxc10	G	A	15: 102,967,318	S154N	possibly damaging	Het
Ice2	A	T	9: 69,412,369	T367S	possibly damaging	Het
Iqca	A	T	1: 90,140,097		probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Klhl14	T	A	18: 21,651,620	H250L	probably damaging	Het
Kmt2c	A	T	5: 25,330,803	D1447E	probably benign	Het
Larp1	G	T	11: 58,049,939	M630I	probably benign	Het
Lrp2	A	G	2: 69,496,323		probably null	Het
Map4k3	G	T	17: 80,603,998	Q673K	probably benign	Het
Mettl16	A	G	11: 74,795,997	N201D	possibly damaging	Het
Mrpl15	C	A	1: 4,785,733		probably benign	Het
Mthfd1l	T	A	10: 4,048,222	V655D	probably damaging	Het
Odf1	T	C	15: 38,226,287	Y144H	probably damaging	Het
Olfr1093	G	T	2: 86,786,227	V166L	probably benign	Het
Olfr38	G	T	6: 42,762,559	C169F	probably damaging	Het
Padi1	T	C	4: 140,814,829	Y594C	probably damaging	Het
Palm3	T	A	8: 84,029,420	D520E	probably benign	Het
Paox	G	A	7: 140,127,654	C130Y	probably damaging	Het
Parpbp	T	A	10: 88,139,907	S115C	probably damaging	Het
Pcnx3	A	G	19: 5,671,680	V1438A	possibly damaging	Het
Pdlim2	T	A	14: 70,167,780	D212V	probably benign	Het
Pi4ka	A	G	16: 17,303,142	F53L	probably damaging	Het
Pik3c2a	A	T	7: 116,368,184	D839E	probably damaging	Het
Pou2f1	T	C	1: 165,883,056		probably benign	Het
Prelid3a	C	T	18: 67,464,941	S6L	probably benign	Het
Ptk2	T	G	15: 73,303,833	D285A	possibly damaging	Het
Rasd2	T	G	8: 75,222,183	Y246D	probably damaging	Het
Rhbdl2	A	G	4: 123,814,327	T110A	probably benign	Het
Rhobtb1	T	A	10: 69,270,255	F217I	probably damaging	Het
Serhl	T	C	15: 83,103,036		probably benign	Het
Sh3tc2	A	G	18: 61,990,007	E613G	probably damaging	Het
Slc26a3	A	G	12: 31,452,715		probably benign	Het
Steap4	T	C	5: 7,975,769	I110T	probably benign	Het
Syde1	C	A	10: 78,589,316	R287L	possibly damaging	Het
Tmem184c	C	T	8: 77,598,662		probably null	Het
Trmt44	C	A	5: 35,572,688		probably benign	Het
Ttbk2	G	T	2: 120,773,283	S256R	probably benign	Het
Ttll6	A	T	11: 96,145,510	I322F	probably damaging	Het
Ubap2	A	T	4: 41,205,753		probably null	Het
Wsb2	A	T	5: 117,377,535	T402S	probably damaging	Het

Other mutations in Ppl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Ppl	APN	16	5089545	missense	probably benign	0.41
IGL00484:Ppl	APN	16	5087952	missense	probably benign	0.13
IGL00654:Ppl	APN	16	5087308	missense	possibly damaging	0.94
IGL00832:Ppl	APN	16	5088975	missense	probably damaging	1.00
IGL01104:Ppl	APN	16	5094491	missense	probably benign	0.01
IGL01327:Ppl	APN	16	5087644	missense	probably benign	0.19
IGL01644:Ppl	APN	16	5091855	missense	probably damaging	1.00
IGL01824:Ppl	APN	16	5087889	missense	probably damaging	1.00
IGL02071:Ppl	APN	16	5113072	missense	probably benign	0.04
IGL02085:Ppl	APN	16	5089816	missense	probably benign	0.09
IGL02282:Ppl	APN	16	5101458	missense	probably damaging	1.00
IGL02635:Ppl	APN	16	5089767	missense	probably benign	0.01
IGL02649:Ppl	APN	16	5087463	missense	probably damaging	1.00
IGL02888:Ppl	APN	16	5100407	missense	possibly damaging	0.89
IGL03305:Ppl	APN	16	5093233	missense	possibly damaging	0.62
G4846:Ppl	UTSW	16	5087206	missense	probably damaging	1.00
IGL03097:Ppl	UTSW	16	5096726	missense	probably damaging	0.98
R0759:Ppl	UTSW	16	5089777	missense	probably benign	0.00
R0786:Ppl	UTSW	16	5089054	missense	probably damaging	1.00
R1024:Ppl	UTSW	16	5100000	missense	probably damaging	1.00
R1498:Ppl	UTSW	16	5104765	missense	probably benign	0.05
R1544:Ppl	UTSW	16	5102597	nonsense	probably null
R1597:Ppl	UTSW	16	5107574	missense	probably benign	0.20
R1863:Ppl	UTSW	16	5087980	missense	possibly damaging	0.69
R1921:Ppl	UTSW	16	5106124	missense	possibly damaging	0.80
R2230:Ppl	UTSW	16	5088981	missense	possibly damaging	0.51
R2275:Ppl	UTSW	16	5094552	missense	probably benign	0.00
R2355:Ppl	UTSW	16	5094497	missense	probably benign	0.00
R3410:Ppl	UTSW	16	5107517	missense	possibly damaging	0.81
R3737:Ppl	UTSW	16	5106857	missense	probably benign
R3797:Ppl	UTSW	16	5104550	splice site	probably benign
R3968:Ppl	UTSW	16	5100332	splice site	probably null
R3970:Ppl	UTSW	16	5100332	splice site	probably null
R4034:Ppl	UTSW	16	5106857	missense	probably benign
R4583:Ppl	UTSW	16	5104536	missense	probably benign	0.02
R4639:Ppl	UTSW	16	5089446	missense	probably damaging	1.00
R4762:Ppl	UTSW	16	5088982	missense	probably benign	0.00
R4828:Ppl	UTSW	16	5104926	missense	probably damaging	1.00
R4869:Ppl	UTSW	16	5104889	missense	probably damaging	0.99
R4925:Ppl	UTSW	16	5104982	missense	probably damaging	1.00
R4983:Ppl	UTSW	16	5088718	missense	possibly damaging	0.75
R4984:Ppl	UTSW	16	5087641	missense	probably benign
R4997:Ppl	UTSW	16	5089371	missense	probably damaging	1.00
R5072:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5073:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5074:Ppl	UTSW	16	5088878	missense	probably benign	0.01
R5286:Ppl	UTSW	16	5089123	nonsense	probably null
R5398:Ppl	UTSW	16	5104922	missense	probably benign	0.00
R5448:Ppl	UTSW	16	5107566	missense	probably benign
R5664:Ppl	UTSW	16	5106055	missense	probably benign	0.00
R5873:Ppl	UTSW	16	5106049	critical splice donor site	probably null
R5918:Ppl	UTSW	16	5104901	missense	probably benign	0.00
R6038:Ppl	UTSW	16	5102581	missense	possibly damaging	0.94
R6038:Ppl	UTSW	16	5102581	missense	possibly damaging	0.94
R6088:Ppl	UTSW	16	5104988	missense	possibly damaging	0.73
R6149:Ppl	UTSW	16	5107596	nonsense	probably null
R6358:Ppl	UTSW	16	5087929	nonsense	probably null
R6379:Ppl	UTSW	16	5097691	missense	probably benign	0.02
R6468:Ppl	UTSW	16	5092441	missense	probably damaging	1.00
R6514:Ppl	UTSW	16	5087317	missense	probably damaging	1.00
R6528:Ppl	UTSW	16	5087616	missense	probably benign	0.00
R6703:Ppl	UTSW	16	5089464	missense	probably damaging	0.99
R6721:Ppl	UTSW	16	5107469	missense	probably damaging	0.97
R6811:Ppl	UTSW	16	5089144	missense	probably damaging	0.99
R6934:Ppl	UTSW	16	5094509	missense	probably benign	0.00
R7034:Ppl	UTSW	16	5087502	missense	probably benign	0.29
R7076:Ppl	UTSW	16	5100119	missense	probably damaging	1.00
R7300:Ppl	UTSW	16	5102371	missense	possibly damaging	0.87
R7349:Ppl	UTSW	16	5104729	missense	probably damaging	0.99
R7359:Ppl	UTSW	16	5089341	missense	possibly damaging	0.78
R7378:Ppl	UTSW	16	5112996	missense	possibly damaging	0.91
R7383:Ppl	UTSW	16	5097971	missense	probably damaging	1.00
R7389:Ppl	UTSW	16	5106713	splice site	probably null
R7445:Ppl	UTSW	16	5089068	missense	probably damaging	1.00
R7687:Ppl	UTSW	16	5097942	missense	probably benign	0.00
R7752:Ppl	UTSW	16	5102302	missense	probably benign	0.09
R7827:Ppl	UTSW	16	5087964	missense	probably damaging	1.00
R7836:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R7842:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R7896:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R7898:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R7943:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R8122:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R8126:Ppl	UTSW	16	5088861	missense	probably damaging	1.00
R8284:Ppl	UTSW	16	5132337	missense	probably damaging	1.00
RF009:Ppl	UTSW	16	5097931	missense	probably benign	0.00
X0054:Ppl	UTSW	16	5104902	missense	probably benign	0.00
Z1088:Ppl	UTSW	16	5089507	missense	probably damaging	0.97
Z1176:Ppl	UTSW	16	5106778	missense	probably damaging	0.99
Z1177:Ppl	UTSW	16	5097957	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTACTACCTCCTGGCGTACAAC -3'
(R):5'- AGAGCTACCAGAGTGAGCTG -3'

Sequencing Primer
(F):5'- GATCTTCTCTTCCTGGGATGC -3'
(R):5'- AGTGAGCTGGAGGCCCTAC -3'

Posted On

2017-03-31