Mutagenetix > Incidental Mutation

Incidental Mutation 'R5951:Apc'

470922

Institutional Source

Beutler Lab

Gene Symbol

Apc

Ensembl Gene

ENSMUSG00000005871

Gene Name

adenomatosis polyposis coli

Synonyms

CC1, Min

MMRRC Submission

044141-MU

Accession Numbers

Ncbi RefSeq: NM_007462.3; MGI:88039

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R5951 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34220924-34322189 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 34317146 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Leucine at position 2331 (S2331L)

Ref Sequence

ENSEMBL: ENSMUSP00000111447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079362
AA Change: S2365L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871
AA Change: S2365L

Domain	Start	End	E-Value	Type
Pfam:APC_N_CC	4	55	6e-32	PFAM
low complexity region	92	109	N/A	INTRINSIC
Pfam:Suppressor_APC	125	205	2e-24	PFAM
low complexity region	211	222	N/A	INTRINSIC
low complexity region	234	247	N/A	INTRINSIC
ARM	338	390	6.14e-5	SMART
ARM	457	508	1.62e-4	SMART
ARM	510	551	8.56e-4	SMART
ARM	554	595	4.45e-2	SMART
ARM	597	642	5.76e1	SMART
ARM	647	687	1.29e-7	SMART
Pfam:Arm_APC_u3	730	1017	5e-170	PFAM
Pfam:APC_15aa	1018	1032	1.1e-8	PFAM
Pfam:APC_u5	1034	1133	7.6e-55	PFAM
Pfam:APC_15aa	1154	1168	1.6e-8	PFAM
Pfam:APC_15aa	1171	1185	1.9e-9	PFAM
low complexity region	1187	1204	N/A	INTRINSIC
Pfam:APC_crr	1255	1279	1.5e-15	PFAM
Pfam:APC_u9	1280	1367	1.9e-34	PFAM
Pfam:APC_crr	1370	1393	2.2e-10	PFAM
low complexity region	1431	1449	N/A	INTRINSIC
Pfam:APC_crr	1485	1509	2.1e-9	PFAM
low complexity region	1532	1548	N/A	INTRINSIC
Pfam:SAMP	1568	1587	2.7e-11	PFAM
Pfam:APC_crr	1635	1659	1.9e-15	PFAM
Pfam:APC_u13	1660	1716	1.3e-31	PFAM
Pfam:SAMP	1717	1736	3.2e-12	PFAM
Pfam:APC_u14	1737	1837	1e-46	PFAM
Pfam:APC_crr	1839	1864	6.8e-15	PFAM
Pfam:APC_u15	1865	1945	1.8e-40	PFAM
Pfam:APC_crr	1947	1971	1.6e-14	PFAM
Pfam:APC_crr	2007	2030	1.8e-14	PFAM
Pfam:SAMP	2033	2052	1.6e-13	PFAM
low complexity region	2112	2146	N/A	INTRINSIC
Pfam:APC_basic	2223	2579	1.5e-110	PFAM
low complexity region	2626	2638	N/A	INTRINSIC
Pfam:EB1_binding	2670	2842	9.3e-89	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115781
AA Change: S2331L

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871
AA Change: S2331L

Domain	Start	End	E-Value	Type
PDB:1DEB\|B	2	55	1e-27	PDB
low complexity region	92	109	N/A	INTRINSIC
Pfam:Suppressor_APC	124	206	1.5e-31	PFAM
low complexity region	211	222	N/A	INTRINSIC
ARM	304	356	6.14e-5	SMART
ARM	423	474	1.62e-4	SMART
ARM	476	517	8.56e-4	SMART
ARM	520	561	4.45e-2	SMART
ARM	563	608	5.76e1	SMART
ARM	613	653	1.29e-7	SMART
Pfam:Arm	655	695	1.7e-6	PFAM
low complexity region	797	810	N/A	INTRINSIC
low complexity region	880	892	N/A	INTRINSIC
low complexity region	923	935	N/A	INTRINSIC
Pfam:APC_15aa	984	999	3.7e-9	PFAM
Pfam:APC_15aa	1100	1115	8.4e-8	PFAM
Pfam:APC_15aa	1120	1135	9.9e-9	PFAM
Pfam:APC_15aa	1137	1152	1.2e-9	PFAM
low complexity region	1153	1170	N/A	INTRINSIC
Pfam:APC_crr	1220	1245	7.5e-15	PFAM
low complexity region	1320	1331	N/A	INTRINSIC
Pfam:APC_crr	1334	1359	2.8e-11	PFAM
low complexity region	1397	1415	N/A	INTRINSIC
Pfam:APC_crr	1450	1475	2.2e-8	PFAM
low complexity region	1498	1514	N/A	INTRINSIC
Pfam:SAMP	1533	1553	8.4e-12	PFAM
Pfam:APC_crr	1600	1625	3.5e-13	PFAM
Pfam:SAMP	1682	1702	5e-12	PFAM
low complexity region	1732	1744	N/A	INTRINSIC
Pfam:APC_crr	1805	1830	3.1e-12	PFAM
low complexity region	1866	1877	N/A	INTRINSIC
Pfam:APC_crr	1912	1937	3.5e-13	PFAM
Pfam:APC_crr	1971	1996	7.1e-14	PFAM
Pfam:SAMP	1999	2018	4.6e-13	PFAM
low complexity region	2078	2112	N/A	INTRINSIC
Pfam:APC_basic	2189	2545	1.1e-131	PFAM
low complexity region	2592	2604	N/A	INTRINSIC
Pfam:EB1_binding	2636	2808	2.9e-90	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165590

SMART Domains

Protein: ENSMUSP00000128327
Gene: ENSMUSG00000005871

Domain	Start	End	E-Value	Type
PDB:3AU3\|A	2	33	2e-17	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000171187

SMART Domains

Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
low complexity region	23	52	N/A	INTRINSIC
low complexity region	102	119	N/A	INTRINSIC
Pfam:Suppressor_APC	134	216	5.2e-32	PFAM
ARM	320	372	6.14e-5	SMART
ARM	439	490	1.62e-4	SMART
ARM	492	533	8.56e-4	SMART
ARM	536	577	4.45e-2	SMART
ARM	579	624	5.76e1	SMART
ARM	629	669	1.29e-7	SMART
Pfam:Arm	671	711	6.3e-7	PFAM
low complexity region	813	826	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
Pfam:APC_15aa	1000	1015	1.4e-9	PFAM
Pfam:APC_15aa	1116	1131	3.1e-8	PFAM

Meta Mutation Damage Score

0.1137

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

100% (78/78)

MGI Phenotype

Strain: 1856318; 2387050; 1857951; 1857957
Lethality: E8-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]

Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	A	2: 35,354,799	E180D	probably damaging	Het
Add3	A	G	19: 53,244,289		probably null	Het
Adgrv1	A	T	13: 81,442,501	I4396N	probably damaging	Het
Apoh	G	T	11: 108,395,903	C51F	probably damaging	Het
Arid4b	T	C	13: 14,143,063	V177A	possibly damaging	Het
Atp13a1	T	A	8: 69,797,285	I343N	probably damaging	Het
Bcar1	T	C	8: 111,713,400	D654G	probably benign	Het
Brox	T	C	1: 183,282,508	K245R	probably damaging	Het
Ccdc146	A	T	5: 21,319,579	S258R	possibly damaging	Het
Ccdc169	A	C	3: 55,140,141	K18Q	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Crot	C	A	5: 8,969,120	E478*	probably null	Het
Dgkq	A	T	5: 108,654,370	M443K	probably damaging	Het
Dhx32	A	T	7: 133,737,328	L326Q	probably damaging	Het
Dtwd1	A	G	2: 126,158,422	I93V	probably benign	Het
Ehmt2	C	T	17: 34,899,381	T44I	probably benign	Het
Enc1	T	C	13: 97,245,257	S92P	probably benign	Het
Epha5	T	C	5: 84,331,192		probably benign	Het
Eya4	T	A	10: 23,155,994	S244C	probably damaging	Het
Fmnl3	G	A	15: 99,325,910	R302W	probably damaging	Het
Fscn3	A	T	6: 28,436,174	I490F	possibly damaging	Het
Galntl6	A	G	8: 57,962,402	V239A	probably benign	Het
Glg1	T	C	8: 111,165,691	I841V	possibly damaging	Het
Gm15455	T	C	1: 33,837,812		noncoding transcript	Het
Gpd1l	C	T	9: 114,914,405	M142I	probably benign	Het
Helb	A	G	10: 120,091,748	V819A	possibly damaging	Het
Hnrnpul2	T	G	19: 8,824,891	F374C	probably damaging	Het
Hoxc10	G	A	15: 102,967,318	S154N	possibly damaging	Het
Ice2	A	T	9: 69,412,369	T367S	possibly damaging	Het
Iqca	A	T	1: 90,140,097		probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Klhl14	T	A	18: 21,651,620	H250L	probably damaging	Het
Kmt2c	A	T	5: 25,330,803	D1447E	probably benign	Het
Larp1	G	T	11: 58,049,939	M630I	probably benign	Het
Lrp2	A	G	2: 69,496,323		probably null	Het
Map4k3	G	T	17: 80,603,998	Q673K	probably benign	Het
Mettl16	A	G	11: 74,795,997	N201D	possibly damaging	Het
Mrpl15	C	A	1: 4,785,733		probably benign	Het
Mthfd1l	T	A	10: 4,048,222	V655D	probably damaging	Het
Odf1	T	C	15: 38,226,287	Y144H	probably damaging	Het
Olfr1093	G	T	2: 86,786,227	V166L	probably benign	Het
Olfr38	G	T	6: 42,762,559	C169F	probably damaging	Het
Padi1	T	C	4: 140,814,829	Y594C	probably damaging	Het
Palm3	T	A	8: 84,029,420	D520E	probably benign	Het
Paox	G	A	7: 140,127,654	C130Y	probably damaging	Het
Parpbp	T	A	10: 88,139,907	S115C	probably damaging	Het
Pcnx3	A	G	19: 5,671,680	V1438A	possibly damaging	Het
Pdlim2	T	A	14: 70,167,780	D212V	probably benign	Het
Pi4ka	A	G	16: 17,303,142	F53L	probably damaging	Het
Pik3c2a	A	T	7: 116,368,184	D839E	probably damaging	Het
Pou2f1	T	C	1: 165,883,056		probably benign	Het
Ppl	A	T	16: 5,088,628	Y1268N	probably benign	Het
Prelid3a	C	T	18: 67,464,941	S6L	probably benign	Het
Ptk2	T	G	15: 73,303,833	D285A	possibly damaging	Het
Rasd2	T	G	8: 75,222,183	Y246D	probably damaging	Het
Rhbdl2	A	G	4: 123,814,327	T110A	probably benign	Het
Rhobtb1	T	A	10: 69,270,255	F217I	probably damaging	Het
Serhl	T	C	15: 83,103,036		probably benign	Het
Sh3tc2	A	G	18: 61,990,007	E613G	probably damaging	Het
Slc26a3	A	G	12: 31,452,715		probably benign	Het
Steap4	T	C	5: 7,975,769	I110T	probably benign	Het
Syde1	C	A	10: 78,589,316	R287L	possibly damaging	Het
Tmem184c	C	T	8: 77,598,662		probably null	Het
Trmt44	C	A	5: 35,572,688		probably benign	Het
Ttbk2	G	T	2: 120,773,283	S256R	probably benign	Het
Ttll6	A	T	11: 96,145,510	I322F	probably damaging	Het
Ubap2	A	T	4: 41,205,753		probably null	Het
Wsb2	A	T	5: 117,377,535	T402S	probably damaging	Het

Other mutations in Apc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Apc	APN	18	34316926	missense	probably benign	0.01
IGL00898:Apc	APN	18	34317094	missense	probably damaging	1.00
IGL01111:Apc	APN	18	34315136	missense	possibly damaging	0.95
IGL01347:Apc	APN	18	34317670	missense	probably damaging	1.00
IGL01375:Apc	APN	18	34313654	missense	probably damaging	1.00
IGL01805:Apc	APN	18	34318218	missense	probably benign	0.02
IGL01997:Apc	APN	18	34315423	missense	probably benign	0.00
IGL02033:Apc	APN	18	34310719	missense	probably damaging	1.00
IGL02323:Apc	APN	18	34315810	nonsense	probably null
IGL02373:Apc	APN	18	34316159	missense	probably damaging	1.00
IGL02379:Apc	APN	18	34298745	missense	probably benign	0.45
IGL02456:Apc	APN	18	34313882	nonsense	probably null
IGL02552:Apc	APN	18	34312982	missense	possibly damaging	0.90
IGL02676:Apc	APN	18	34315634	missense	probably damaging	1.00
IGL02756:Apc	APN	18	34314535	missense	probably damaging	1.00
IGL02938:Apc	APN	18	34315228	missense	probably damaging	0.98
IGL02974:Apc	APN	18	34268383	splice site	probably benign
IGL03124:Apc	APN	18	34299985	missense	probably damaging	0.98
IGL03201:Apc	APN	18	34312376	missense	probably damaging	1.00
IGL03339:Apc	APN	18	34298474	missense	probably damaging	1.00
FR4304:Apc	UTSW	18	34281997	intron	probably benign
FR4342:Apc	UTSW	18	34281999	intron	probably benign
FR4449:Apc	UTSW	18	34282000	intron	probably benign
FR4449:Apc	UTSW	18	34282005	intron	probably benign
FR4548:Apc	UTSW	18	34281998	intron	probably benign
FR4737:Apc	UTSW	18	34281999	intron	probably benign
FR4976:Apc	UTSW	18	34281998	intron	probably benign
FR4976:Apc	UTSW	18	34282000	intron	probably benign
FR4976:Apc	UTSW	18	34282004	nonsense	probably null
R0385:Apc	UTSW	18	34315944	missense	probably damaging	1.00
R0535:Apc	UTSW	18	34261072	missense	probably damaging	1.00
R0561:Apc	UTSW	18	34313303	missense	possibly damaging	0.94
R0590:Apc	UTSW	18	34316230	nonsense	probably null
R0626:Apc	UTSW	18	34318454	missense	probably damaging	1.00
R0991:Apc	UTSW	18	34316107	missense	probably damaging	1.00
R1564:Apc	UTSW	18	34315149	missense	probably benign	0.00
R1663:Apc	UTSW	18	34268325	missense	probably damaging	0.98
R1737:Apc	UTSW	18	34317022	missense	probably damaging	1.00
R1739:Apc	UTSW	18	34312318	missense	probably damaging	1.00
R1835:Apc	UTSW	18	34317077	missense	probably damaging	1.00
R1887:Apc	UTSW	18	34272468	missense	probably damaging	1.00
R1957:Apc	UTSW	18	34317335	missense	probably damaging	1.00
R1974:Apc	UTSW	18	34300004	missense	possibly damaging	0.62
R2005:Apc	UTSW	18	34310909	critical splice donor site	probably null
R2013:Apc	UTSW	18	34315591	missense	probably damaging	0.98
R2014:Apc	UTSW	18	34315591	missense	probably damaging	0.98
R2015:Apc	UTSW	18	34315591	missense	probably damaging	0.98
R2017:Apc	UTSW	18	34313602	missense	probably benign	0.00
R2056:Apc	UTSW	18	34316428	missense	probably damaging	1.00
R2108:Apc	UTSW	18	34269229	missense	probably damaging	1.00
R2120:Apc	UTSW	18	34276601	missense	probably damaging	1.00
R2131:Apc	UTSW	18	34312045	missense	possibly damaging	0.51
R2133:Apc	UTSW	18	34312045	missense	possibly damaging	0.51
R2291:Apc	UTSW	18	34312491	missense	probably benign	0.45
R2332:Apc	UTSW	18	34317059	missense	possibly damaging	0.50
R2360:Apc	UTSW	18	34261126	missense	probably damaging	1.00
R2407:Apc	UTSW	18	34314262	missense	possibly damaging	0.77
R2507:Apc	UTSW	18	34316537	missense	possibly damaging	0.77
R2940:Apc	UTSW	18	34276670	missense	probably damaging	1.00
R3404:Apc	UTSW	18	34313602	missense	probably benign	0.00
R3411:Apc	UTSW	18	34269259	splice site	probably benign
R3778:Apc	UTSW	18	34313081	missense	probably damaging	1.00
R3826:Apc	UTSW	18	34279335	missense	possibly damaging	0.93
R4599:Apc	UTSW	18	34317987	nonsense	probably null
R4611:Apc	UTSW	18	34318565	missense	probably damaging	1.00
R4664:Apc	UTSW	18	34298594	missense	probably damaging	0.98
R4969:Apc	UTSW	18	34312918	nonsense	probably null
R5007:Apc	UTSW	18	34312963	missense	probably damaging	1.00
R5066:Apc	UTSW	18	34316105	missense	probably damaging	1.00
R5112:Apc	UTSW	18	34316109	nonsense	probably null
R5259:Apc	UTSW	18	34314290	missense	probably benign	0.29
R5440:Apc	UTSW	18	34221160	unclassified	probably benign
R5508:Apc	UTSW	18	34298580	missense	probably damaging	0.97
R5512:Apc	UTSW	18	34310909	critical splice donor site	probably benign
R5850:Apc	UTSW	18	34318063	missense	possibly damaging	0.94
R5966:Apc	UTSW	18	34221087	utr 5 prime	probably benign
R6081:Apc	UTSW	18	34290111	missense	possibly damaging	0.93
R6116:Apc	UTSW	18	34316455	missense	probably damaging	1.00
R6351:Apc	UTSW	18	34312212	missense	probably damaging	1.00
R6354:Apc	UTSW	18	34312528	missense	probably benign	0.02
R6467:Apc	UTSW	18	34269199	missense	probably benign	0.22
R6974:Apc	UTSW	18	34298427	missense	possibly damaging	0.65
R7027:Apc	UTSW	18	34312076	missense	probably damaging	1.00
R7096:Apc	UTSW	18	34315957	missense	probably damaging	1.00
R7289:Apc	UTSW	18	34315271	missense	probably damaging	1.00
R7439:Apc	UTSW	18	34312073	missense	probably damaging	1.00
R7441:Apc	UTSW	18	34312073	missense	probably damaging	1.00
R7534:Apc	UTSW	18	34316962	missense	probably damaging	1.00
R7685:Apc	UTSW	18	34314208	missense	probably damaging	1.00
R7814:Apc	UTSW	18	34272539	missense	probably damaging	0.98
R7954:Apc	UTSW	18	34314268	missense	probably damaging	0.99
R8352:Apc	UTSW	18	34312751	missense	possibly damaging	0.54
R8452:Apc	UTSW	18	34312751	missense	possibly damaging	0.54
R8497:Apc	UTSW	18	34313030	missense	possibly damaging	0.81
R8545:Apc	UTSW	18	34317031	missense	possibly damaging	0.94
R8554:Apc	UTSW	18	34312946	missense	probably damaging	1.00
R8955:Apc	UTSW	18	34268317	missense	probably damaging	1.00
R9014:Apc	UTSW	18	34221021	start gained	probably benign
R9061:Apc	UTSW	18	34313198	missense	probably damaging	1.00
R9147:Apc	UTSW	18	34317657	missense	probably damaging	1.00
R9318:Apc	UTSW	18	34313987	missense	possibly damaging	0.69
R9521:Apc	UTSW	18	34312685	missense	probably benign	0.24
R9546:Apc	UTSW	18	34312258	missense	possibly damaging	0.86
R9547:Apc	UTSW	18	34312258	missense	possibly damaging	0.86
R9557:Apc	UTSW	18	34318359	missense	probably damaging	1.00
R9592:Apc	UTSW	18	34310770	nonsense	probably null
R9675:Apc	UTSW	18	34316194	missense	probably damaging	1.00
R9736:Apc	UTSW	18	34317770	missense	probably damaging	1.00
R9792:Apc	UTSW	18	34314575	missense	probably damaging	1.00
R9793:Apc	UTSW	18	34314575	missense	probably damaging	1.00
R9795:Apc	UTSW	18	34314575	missense	probably damaging	1.00
RF046:Apc	UTSW	18	34282009	critical splice donor site	probably benign
RF063:Apc	UTSW	18	34282009	critical splice donor site	probably benign
X0021:Apc	UTSW	18	34312108	missense	probably damaging	1.00
X0025:Apc	UTSW	18	34312376	missense	probably damaging	1.00
Z1088:Apc	UTSW	18	34313167	nonsense	probably null
Z1177:Apc	UTSW	18	34314463	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GATCTAGAGACTCCACTCCCTC -3'
(R):5'- ATGCAGGCCTTTCTGATCTG -3'

Sequencing Primer
(F):5'- TCTAGAGACTCCACTCCCTCAAGAC -3'
(R):5'- CACTTCCACTTGATTTAGTTGAAGAC -3'

Posted On

2017-03-31