Mutagenetix > Incidental Mutation

Incidental Mutation 'R5951:Add3'

470925

Institutional Source

Beutler Lab

Gene Symbol

Add3

Ensembl Gene

ENSMUSG00000025026

Gene Name

adducin 3 (gamma)

Synonyms

MMRRC Submission

044141-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5951 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53140445-53247399 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 53244289 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000107370 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025999] [ENSMUST00000050096] [ENSMUST00000111741]

AlphaFold

Q9QYB5

Predicted Effect

probably null
Transcript: ENSMUST00000025999

SMART Domains

Protein: ENSMUSP00000025999
Gene: ENSMUSG00000025026

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	101	114	N/A	INTRINSIC
Aldolase_II	139	321	1.62e-46	SMART
coiled coil region	556	582	N/A	INTRINSIC
low complexity region	590	605	N/A	INTRINSIC
low complexity region	650	662	N/A	INTRINSIC
low complexity region	673	703	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000050096

SMART Domains

Protein: ENSMUSP00000052245
Gene: ENSMUSG00000025026

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	101	114	N/A	INTRINSIC
Aldolase_II	139	321	1.62e-46	SMART
low complexity region	618	630	N/A	INTRINSIC
low complexity region	641	671	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000111741

SMART Domains

Protein: ENSMUSP00000107370
Gene: ENSMUSG00000025026

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	101	114	N/A	INTRINSIC
Aldolase_II	139	321	1.62e-46	SMART
coiled coil region	556	582	N/A	INTRINSIC
low complexity region	590	605	N/A	INTRINSIC
low complexity region	650	662	N/A	INTRINSIC
low complexity region	673	703	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.6%
20x: 92.4%

Validation Efficiency

100% (78/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described. The functions of the different isoforms are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal blood pressure and show no significant alterations in red blood cell or platelet structure and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930568D16Rik	T	A	2: 35,354,799	E180D	probably damaging	Het
Adgrv1	A	T	13: 81,442,501	I4396N	probably damaging	Het
Apc	C	T	18: 34,317,146	S2331L	possibly damaging	Het
Apoh	G	T	11: 108,395,903	C51F	probably damaging	Het
Arid4b	T	C	13: 14,143,063	V177A	possibly damaging	Het
Atp13a1	T	A	8: 69,797,285	I343N	probably damaging	Het
Bcar1	T	C	8: 111,713,400	D654G	probably benign	Het
Brox	T	C	1: 183,282,508	K245R	probably damaging	Het
Ccdc146	A	T	5: 21,319,579	S258R	possibly damaging	Het
Ccdc169	A	C	3: 55,140,141	K18Q	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Crot	C	A	5: 8,969,120	E478*	probably null	Het
Dgkq	A	T	5: 108,654,370	M443K	probably damaging	Het
Dhx32	A	T	7: 133,737,328	L326Q	probably damaging	Het
Dtwd1	A	G	2: 126,158,422	I93V	probably benign	Het
Ehmt2	C	T	17: 34,899,381	T44I	probably benign	Het
Enc1	T	C	13: 97,245,257	S92P	probably benign	Het
Epha5	T	C	5: 84,331,192		probably benign	Het
Eya4	T	A	10: 23,155,994	S244C	probably damaging	Het
Fmnl3	G	A	15: 99,325,910	R302W	probably damaging	Het
Fscn3	A	T	6: 28,436,174	I490F	possibly damaging	Het
Galntl6	A	G	8: 57,962,402	V239A	probably benign	Het
Glg1	T	C	8: 111,165,691	I841V	possibly damaging	Het
Gm15455	T	C	1: 33,837,812		noncoding transcript	Het
Gpd1l	C	T	9: 114,914,405	M142I	probably benign	Het
Helb	A	G	10: 120,091,748	V819A	possibly damaging	Het
Hnrnpul2	T	G	19: 8,824,891	F374C	probably damaging	Het
Hoxc10	G	A	15: 102,967,318	S154N	possibly damaging	Het
Ice2	A	T	9: 69,412,369	T367S	possibly damaging	Het
Iqca	A	T	1: 90,140,097		probably null	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Klhl14	T	A	18: 21,651,620	H250L	probably damaging	Het
Kmt2c	A	T	5: 25,330,803	D1447E	probably benign	Het
Larp1	G	T	11: 58,049,939	M630I	probably benign	Het
Lrp2	A	G	2: 69,496,323		probably null	Het
Map4k3	G	T	17: 80,603,998	Q673K	probably benign	Het
Mettl16	A	G	11: 74,795,997	N201D	possibly damaging	Het
Mrpl15	C	A	1: 4,785,733		probably benign	Het
Mthfd1l	T	A	10: 4,048,222	V655D	probably damaging	Het
Odf1	T	C	15: 38,226,287	Y144H	probably damaging	Het
Olfr1093	G	T	2: 86,786,227	V166L	probably benign	Het
Olfr38	G	T	6: 42,762,559	C169F	probably damaging	Het
Padi1	T	C	4: 140,814,829	Y594C	probably damaging	Het
Palm3	T	A	8: 84,029,420	D520E	probably benign	Het
Paox	G	A	7: 140,127,654	C130Y	probably damaging	Het
Parpbp	T	A	10: 88,139,907	S115C	probably damaging	Het
Pcnx3	A	G	19: 5,671,680	V1438A	possibly damaging	Het
Pdlim2	T	A	14: 70,167,780	D212V	probably benign	Het
Pi4ka	A	G	16: 17,303,142	F53L	probably damaging	Het
Pik3c2a	A	T	7: 116,368,184	D839E	probably damaging	Het
Pou2f1	T	C	1: 165,883,056		probably benign	Het
Ppl	A	T	16: 5,088,628	Y1268N	probably benign	Het
Prelid3a	C	T	18: 67,464,941	S6L	probably benign	Het
Ptk2	T	G	15: 73,303,833	D285A	possibly damaging	Het
Rasd2	T	G	8: 75,222,183	Y246D	probably damaging	Het
Rhbdl2	A	G	4: 123,814,327	T110A	probably benign	Het
Rhobtb1	T	A	10: 69,270,255	F217I	probably damaging	Het
Serhl	T	C	15: 83,103,036		probably benign	Het
Sh3tc2	A	G	18: 61,990,007	E613G	probably damaging	Het
Slc26a3	A	G	12: 31,452,715		probably benign	Het
Steap4	T	C	5: 7,975,769	I110T	probably benign	Het
Syde1	C	A	10: 78,589,316	R287L	possibly damaging	Het
Tmem184c	C	T	8: 77,598,662		probably null	Het
Trmt44	C	A	5: 35,572,688		probably benign	Het
Ttbk2	G	T	2: 120,773,283	S256R	probably benign	Het
Ttll6	A	T	11: 96,145,510	I322F	probably damaging	Het
Ubap2	A	T	4: 41,205,753		probably null	Het
Wsb2	A	T	5: 117,377,535	T402S	probably damaging	Het

Other mutations in Add3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01744:Add3	APN	19	53239430	missense	probably damaging	1.00
IGL02177:Add3	APN	19	53216892	nonsense	probably null
IGL03093:Add3	APN	19	53231207	missense	probably damaging	1.00
IGL03047:Add3	UTSW	19	53242591	missense	probably benign	0.00
PIT4243001:Add3	UTSW	19	53236690	missense	probably benign	0.00
PIT4366001:Add3	UTSW	19	53216867	missense	unknown
R0087:Add3	UTSW	19	53226607	missense	probably damaging	1.00
R0335:Add3	UTSW	19	53236828	missense	probably benign	0.00
R0346:Add3	UTSW	19	53216956	nonsense	probably null
R0514:Add3	UTSW	19	53236843	nonsense	probably null
R0692:Add3	UTSW	19	53216952	missense	probably damaging	1.00
R1437:Add3	UTSW	19	53233678	missense	probably damaging	0.98
R1747:Add3	UTSW	19	53242550	missense	probably benign	0.41
R2926:Add3	UTSW	19	53226822	splice site	probably null
R4192:Add3	UTSW	19	53242524	missense	probably benign	0.00
R4780:Add3	UTSW	19	53234792	missense	possibly damaging	0.64
R5019:Add3	UTSW	19	53242571	missense	probably damaging	0.99
R5486:Add3	UTSW	19	53244387	missense	probably benign	0.00
R5526:Add3	UTSW	19	53226607	missense	probably damaging	1.00
R5580:Add3	UTSW	19	53245211	missense	probably damaging	1.00
R5851:Add3	UTSW	19	53236774	missense	probably damaging	1.00
R5863:Add3	UTSW	19	53233870	missense	probably benign	0.00
R6229:Add3	UTSW	19	53234846	missense	probably benign	0.35
R7017:Add3	UTSW	19	53233853	missense	possibly damaging	0.94
R7190:Add3	UTSW	19	53216899	nonsense	probably null
R7222:Add3	UTSW	19	53216846	missense	unknown
R7231:Add3	UTSW	19	53233146	missense	probably benign	0.00
R7532:Add3	UTSW	19	53232158	missense	probably damaging	1.00
R7557:Add3	UTSW	19	53239437	missense	probably damaging	0.98
R7726:Add3	UTSW	19	53239461	missense	probably damaging	1.00
R9063:Add3	UTSW	19	53233871	missense	probably damaging	0.98
R9069:Add3	UTSW	19	53233901	missense	possibly damaging	0.92
R9371:Add3	UTSW	19	53233068	missense	probably damaging	1.00
R9550:Add3	UTSW	19	53245090	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- AACGCATTCAGTCTCTGTCTG -3'
(R):5'- GGACAAACGACAGGGCTTAC -3'

Sequencing Primer
(F):5'- CAAGTTACTGTTCATGGCCAG -3'
(R):5'- CGACAGGGCTTACGAGGG -3'

Posted On

2017-03-31