Incidental Mutation 'R5952:Glrx2'
ID470929
Institutional Source Beutler Lab
Gene Symbol Glrx2
Ensembl Gene ENSMUSG00000018196
Gene Nameglutaredoxin 2 (thioltransferase)
SynonymsGrx2, 1700010P22Rik
MMRRC Submission 044142-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R5952 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location143716338-143749676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143745134 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 84 (N84D)
Ref Sequence ENSEMBL: ENSMUSP00000141022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050491] [ENSMUST00000111957] [ENSMUST00000129653] [ENSMUST00000145571] [ENSMUST00000145969] [ENSMUST00000185362]
Predicted Effect probably benign
Transcript: ENSMUST00000050491
SMART Domains Protein: ENSMUSP00000053443
Gene: ENSMUSG00000018196

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
Pfam:Glutaredoxin 62 124 1.6e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111957
AA Change: N51D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107588
Gene: ENSMUSG00000018196
AA Change: N51D

DomainStartEndE-ValueType
Pfam:Glutaredoxin 29 91 8.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126514
Predicted Effect probably benign
Transcript: ENSMUST00000129653
AA Change: N51D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121010
Gene: ENSMUSG00000018196
AA Change: N51D

DomainStartEndE-ValueType
Pfam:Glutaredoxin 29 91 8.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145571
AA Change: N84D

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000115893
Gene: ENSMUSG00000018196
AA Change: N84D

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
Pfam:Glutaredoxin 62 117 1.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145969
AA Change: N51D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121665
Gene: ENSMUSG00000018196
AA Change: N51D

DomainStartEndE-ValueType
Pfam:Glutaredoxin 29 91 8.3e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152435
Predicted Effect probably benign
Transcript: ENSMUST00000185362
AA Change: N84D

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000141022
Gene: ENSMUSG00000018196
AA Change: N84D

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
Pfam:Glutaredoxin 62 124 1.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185367
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190211
Meta Mutation Damage Score 0.1941 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 91% (62/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the glutaredoxin family of proteins, which maintain cellular thiol homeostasis. These proteins are thiol-disulfide oxidoreductases that use a glutathione-binding site and one or two active cysteines in their active site. This gene undergoes alternative splicing to produce multiple isoforms, one of which is ubiquitously expressed and localizes to mitochondria, where it functions in mitochondrial redox homeostasis and is important for the protection against and recovery from oxidative stress. Other isoforms, which have more restrictive expression patterns, show cytosolic and nuclear localization, and are thought to function in cellular differentiation and transformation, possibly with a role in tumor progression. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to oxidative stress in primary mouse lens epithelial cells, and an increased level of glutathionylated proteins in mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,965,621 T2060A probably damaging Het
Add2 A T 6: 86,109,746 D296V probably damaging Het
Ak9 A G 10: 41,357,563 E599G possibly damaging Het
Ank3 A T 10: 69,986,463 I1604F probably benign Het
Arid4a A G 12: 71,063,206 D107G probably benign Het
Btn2a2 A T 13: 23,482,808 I209N probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Csmd3 A G 15: 47,733,505 V1979A probably damaging Het
Cyp4a12b C T 4: 115,414,517 R142* probably null Het
Ddx23 A T 15: 98,658,240 S66T unknown Het
Efcab2 A G 1: 178,475,874 K121R probably benign Het
Epb41l1 T A 2: 156,503,788 V237D probably damaging Het
Epb41l1 G T 2: 156,524,983 A579S probably benign Het
Epn1 G A 7: 5,093,912 R231H probably damaging Het
Fbrs T C 7: 127,487,752 S649P probably damaging Het
Fezf1 A G 6: 23,247,428 V216A probably benign Het
Gen1 A T 12: 11,260,896 S112T probably damaging Het
Gm1818 T G 12: 48,555,936 noncoding transcript Het
Hira C A 16: 18,935,065 T553K possibly damaging Het
Hnrnph3 A G 10: 63,015,595 probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Jcad A G 18: 4,674,554 Q772R probably damaging Het
Lamb3 A G 1: 193,332,362 T610A probably benign Het
Map3k19 T C 1: 127,822,740 D958G probably benign Het
Map4k4 G A 1: 39,999,922 probably benign Het
Mocos T C 18: 24,701,387 V827A possibly damaging Het
Ms4a10 T A 19: 10,964,122 D161V probably damaging Het
Myh9 A G 15: 77,773,332 I1071T possibly damaging Het
Myo15 A G 11: 60,479,420 E1002G possibly damaging Het
Neurod6 G A 6: 55,679,017 H212Y probably damaging Het
Olfr1448 T C 19: 12,919,830 N160D probably benign Het
Olfr56 A T 11: 49,134,572 I95F probably damaging Het
Olfr618 T A 7: 103,597,967 I217N probably damaging Het
Pcdhb17 T C 18: 37,487,080 V641A probably benign Het
Ppp3ca A T 3: 136,928,571 M431L probably benign Het
Ptprk A T 10: 28,585,675 I69F probably damaging Het
Rab34 G T 11: 78,190,268 probably benign Het
Rb1cc1 A G 1: 6,248,182 N619S probably benign Het
Rnf169 T C 7: 99,925,633 H585R probably damaging Het
Rps6kc1 A G 1: 190,885,420 V129A probably benign Het
Siglecf C T 7: 43,355,927 T437M probably benign Het
Slc25a2 T C 18: 37,638,282 N65D probably benign Het
Spire1 A G 18: 67,506,709 S245P probably benign Het
Sptb A T 12: 76,632,384 M99K probably benign Het
Tacc1 G T 8: 25,181,995 L406I possibly damaging Het
Tas2r137 T C 6: 40,491,542 I102T probably benign Het
Trappc11 A T 8: 47,496,917 probably null Het
Trbv11 A G 6: 41,107,219 noncoding transcript Het
Trmt11 A G 10: 30,560,842 Y301H probably benign Het
Tspo A G 15: 83,572,240 T75A possibly damaging Het
Ttn T C 2: 76,880,225 probably benign Het
Zfhx4 A G 3: 5,396,970 Q1210R probably damaging Het
Zhx3 A T 2: 160,782,017 Y77N probably damaging Het
Other mutations in Glrx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02161:Glrx2 APN 1 143739683 missense possibly damaging 0.66
R1728:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R1762:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R1783:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R1784:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R1785:Glrx2 UTSW 1 143739740 missense possibly damaging 0.90
R2132:Glrx2 UTSW 1 143745104 missense possibly damaging 0.92
R4362:Glrx2 UTSW 1 143741680 missense possibly damaging 0.71
R5418:Glrx2 UTSW 1 143739708 missense possibly damaging 0.83
R5496:Glrx2 UTSW 1 143745207 missense probably damaging 0.98
R6225:Glrx2 UTSW 1 143745383 intron probably benign
Predicted Primers PCR Primer
(F):5'- ATGACACGTCACTGGAGCAC -3'
(R):5'- TGCTAGCAGGAAAGTCTAGTGTC -3'

Sequencing Primer
(F):5'- ACCGCAGAATCATAATCCTTTTAC -3'
(R):5'- AAGTCTAGTGTCCGGGGAG -3'
Posted On2017-03-31