Incidental Mutation 'R5952:Epb41l1'
ID470935
Institutional Source Beutler Lab
Gene Symbol Epb41l1
Ensembl Gene ENSMUSG00000027624
Gene Nameerythrocyte membrane protein band 4.1 like 1
SynonymsEpb4.1l1, 4.1N
MMRRC Submission 044142-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5952 (G1)
Quality Score168
Status Validated
Chromosome2
Chromosomal Location156420909-156543214 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 156524983 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 579 (A579S)
Ref Sequence ENSEMBL: ENSMUSP00000105205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029155] [ENSMUST00000103135] [ENSMUST00000103136] [ENSMUST00000103137] [ENSMUST00000109574] [ENSMUST00000109577] [ENSMUST00000125153]
Predicted Effect probably benign
Transcript: ENSMUST00000029155
AA Change: A591S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029155
Gene: ENSMUSG00000027624
AA Change: A591S

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 8.4e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 770 867 5.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103135
AA Change: A591S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099424
Gene: ENSMUSG00000027624
AA Change: A591S

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 5.9e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 740 866 1.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103136
AA Change: A591S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099425
Gene: ENSMUSG00000027624
AA Change: A591S

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 8.4e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 770 867 5.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103137
AA Change: A591S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099426
Gene: ENSMUSG00000027624
AA Change: A591S

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 493 544 5.9e-25 PFAM
low complexity region 606 615 N/A INTRINSIC
Pfam:4_1_CTD 740 866 1.6e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109574
SMART Domains Protein: ENSMUSP00000105202
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 458 471 N/A INTRINSIC
Pfam:SAB 480 531 4.8e-24 PFAM
Pfam:4_1_CTD 610 718 4.9e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109577
AA Change: A579S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105205
Gene: ENSMUSG00000027624
AA Change: A579S

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 459 472 N/A INTRINSIC
Pfam:SAB 481 532 5.9e-24 PFAM
low complexity region 594 603 N/A INTRINSIC
Pfam:4_1_CTD 758 855 5.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125153
SMART Domains Protein: ENSMUSP00000121161
Gene: ENSMUSG00000027624

DomainStartEndE-ValueType
low complexity region 14 35 N/A INTRINSIC
B41 93 288 6.19e-78 SMART
FERM_C 292 382 2.47e-39 SMART
FA 384 430 1.9e-17 SMART
low complexity region 458 471 N/A INTRINSIC
Pfam:SAB 492 543 7.4e-25 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.5%
Validation Efficiency 91% (62/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Erythrocyte membrane protein band 4.1 (EPB41) is a multifunctional protein that mediates interactions between the erythrocyte cytoskeleton and the overlying plasma membrane. The encoded protein binds and stabilizes D2 and D3 dopamine receptors at the neuronal plasma membrane. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,965,621 T2060A probably damaging Het
Add2 A T 6: 86,109,746 D296V probably damaging Het
Ak9 A G 10: 41,357,563 E599G possibly damaging Het
Ank3 A T 10: 69,986,463 I1604F probably benign Het
Arid4a A G 12: 71,063,206 D107G probably benign Het
Btn2a2 A T 13: 23,482,808 I209N probably benign Het
Cenps C A 4: 149,130,201 probably benign Het
Csmd3 A G 15: 47,733,505 V1979A probably damaging Het
Cyp4a12b C T 4: 115,414,517 R142* probably null Het
Ddx23 A T 15: 98,658,240 S66T unknown Het
Efcab2 A G 1: 178,475,874 K121R probably benign Het
Epn1 G A 7: 5,093,912 R231H probably damaging Het
Fbrs T C 7: 127,487,752 S649P probably damaging Het
Fezf1 A G 6: 23,247,428 V216A probably benign Het
Gen1 A T 12: 11,260,896 S112T probably damaging Het
Glrx2 A G 1: 143,745,134 N84D probably benign Het
Gm1818 T G 12: 48,555,936 noncoding transcript Het
Hira C A 16: 18,935,065 T553K possibly damaging Het
Hnrnph3 A G 10: 63,015,595 probably benign Het
Ighv12-3 A T 12: 114,366,584 F97Y probably benign Het
Jcad A G 18: 4,674,554 Q772R probably damaging Het
Lamb3 A G 1: 193,332,362 T610A probably benign Het
Map3k19 T C 1: 127,822,740 D958G probably benign Het
Map4k4 G A 1: 39,999,922 probably benign Het
Mocos T C 18: 24,701,387 V827A possibly damaging Het
Ms4a10 T A 19: 10,964,122 D161V probably damaging Het
Myh9 A G 15: 77,773,332 I1071T possibly damaging Het
Myo15 A G 11: 60,479,420 E1002G possibly damaging Het
Neurod6 G A 6: 55,679,017 H212Y probably damaging Het
Olfr1448 T C 19: 12,919,830 N160D probably benign Het
Olfr56 A T 11: 49,134,572 I95F probably damaging Het
Olfr618 T A 7: 103,597,967 I217N probably damaging Het
Pcdhb17 T C 18: 37,487,080 V641A probably benign Het
Ppp3ca A T 3: 136,928,571 M431L probably benign Het
Ptprk A T 10: 28,585,675 I69F probably damaging Het
Rab34 G T 11: 78,190,268 probably benign Het
Rb1cc1 A G 1: 6,248,182 N619S probably benign Het
Rnf169 T C 7: 99,925,633 H585R probably damaging Het
Rps6kc1 A G 1: 190,885,420 V129A probably benign Het
Siglecf C T 7: 43,355,927 T437M probably benign Het
Slc25a2 T C 18: 37,638,282 N65D probably benign Het
Spire1 A G 18: 67,506,709 S245P probably benign Het
Sptb A T 12: 76,632,384 M99K probably benign Het
Tacc1 G T 8: 25,181,995 L406I possibly damaging Het
Tas2r137 T C 6: 40,491,542 I102T probably benign Het
Trappc11 A T 8: 47,496,917 probably null Het
Trbv11 A G 6: 41,107,219 noncoding transcript Het
Trmt11 A G 10: 30,560,842 Y301H probably benign Het
Tspo A G 15: 83,572,240 T75A possibly damaging Het
Ttn T C 2: 76,880,225 probably benign Het
Zfhx4 A G 3: 5,396,970 Q1210R probably damaging Het
Zhx3 A T 2: 160,782,017 Y77N probably damaging Het
Other mutations in Epb41l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Epb41l1 APN 2 156525019 missense probably damaging 1.00
IGL00852:Epb41l1 APN 2 156503718 missense probably damaging 1.00
IGL02148:Epb41l1 APN 2 156511828 intron probably benign
IGL02164:Epb41l1 APN 2 156494949 splice site probably benign
IGL02515:Epb41l1 APN 2 156537013 missense probably damaging 1.00
R0787:Epb41l1 UTSW 2 156494090 missense probably damaging 0.98
R1450:Epb41l1 UTSW 2 156511825 intron probably benign
R1566:Epb41l1 UTSW 2 156521959 missense probably benign 0.06
R1759:Epb41l1 UTSW 2 156521974 missense probably benign 0.06
R1812:Epb41l1 UTSW 2 156496511 missense probably damaging 1.00
R1908:Epb41l1 UTSW 2 156510817 missense possibly damaging 0.80
R2152:Epb41l1 UTSW 2 156514128 missense probably damaging 1.00
R3023:Epb41l1 UTSW 2 156514209 missense probably damaging 0.99
R4178:Epb41l1 UTSW 2 156521557 missense probably benign
R4491:Epb41l1 UTSW 2 156522168 missense probably benign 0.00
R4610:Epb41l1 UTSW 2 156509261 missense possibly damaging 0.71
R4770:Epb41l1 UTSW 2 156529424 missense probably benign 0.00
R5038:Epb41l1 UTSW 2 156521410 missense probably benign 0.12
R5049:Epb41l1 UTSW 2 156524939 missense possibly damaging 0.95
R5129:Epb41l1 UTSW 2 156509281 missense possibly damaging 0.80
R5624:Epb41l1 UTSW 2 156533771 splice site probably benign
R5780:Epb41l1 UTSW 2 156496525 missense probably damaging 1.00
R5810:Epb41l1 UTSW 2 156499655 missense probably damaging 1.00
R5952:Epb41l1 UTSW 2 156503788 missense probably damaging 1.00
R5961:Epb41l1 UTSW 2 156521786 missense probably benign 0.25
R6118:Epb41l1 UTSW 2 156522477 missense probably benign 0.13
R6496:Epb41l1 UTSW 2 156533796 missense possibly damaging 0.92
R6861:Epb41l1 UTSW 2 156525222 missense probably benign
R6959:Epb41l1 UTSW 2 156499587 missense probably benign 0.03
R7009:Epb41l1 UTSW 2 156534683 splice site probably null
R7036:Epb41l1 UTSW 2 156529402 missense probably benign
R7046:Epb41l1 UTSW 2 156526892 missense possibly damaging 0.56
R7263:Epb41l1 UTSW 2 156495123 critical splice donor site probably null
R7322:Epb41l1 UTSW 2 156503851 missense probably damaging 0.98
R7398:Epb41l1 UTSW 2 156534762 missense probably damaging 1.00
R8039:Epb41l1 UTSW 2 156506412 missense probably damaging 0.99
X0065:Epb41l1 UTSW 2 156509277 missense probably damaging 1.00
Z1177:Epb41l1 UTSW 2 156508827 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGATGTCCTCTGGCATTCACC -3'
(R):5'- GATTCATCCTCTTGGCTGGAG -3'

Sequencing Primer
(F):5'- TGGCATTCACCATCTTGACC -3'
(R):5'- TCAGAGTCACTTTTATCCCGATCAAG -3'
Posted On2017-03-31